[go: nahoru, domu]
Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

FastQ contains reads header name only - ERROR: sequence and quality have different length #516

Open
phucty opened this issue Aug 17, 2023 · 2 comments
Open

FastQ contains reads header name only - ERROR: sequence and quality have different length #516

phucty opened this issue Aug 17, 2023 · 2 comments

Comments

@phucty
Copy link
phucty commented Aug 17, 2023

I got the error when running fastp on sample.fastq.gz:
ERROR: sequence and quality have different length
Could you help me resolve the issue? Thank you.

My command:

fastp --in1 "${READS[0]}" \
       --in2 "${READS[1]}" \
       --out1 "${sample_id}_R1_paired.fastq.gz" \
       --out2 "${sample_id}_R2_paired.fastq.gz" \
       --json ${sample_id}_report.fastp.json \
       --html ${sample_id}_report.fastp.html \
       --cut_front 3 \
       --cut_tail 3 \
       --cut_right_window_size 4 \
       --cut_right_mean_quality 15 \
       --length_required 36 \
       --length_limit 75 \
       --thread 16 \
       --dedup \
       --detect_adapter_for_pe \
       --adapter_fasta resources/TruSeq3-PE-2.fa \
       2> ${sample_id}_report.fastp.log

FastQ header only reads:
$ zcat sample.fastq.gz | grep -a5 "@VH00294:10:AAAWTLCHV:2:2510:16243:13628 1:N:0:ATTGCGTG+GTTATGGC"

CCCC;CCCCCC-;CCCCCCCCCCC-C;-CCC-CCCCCCCCCCCCCCC;CCC
@VH00294:10:AAAWTLCHV:2:2510:10108:13628 1:N:0:ATTGTGTG+GTTATGGC
CACGGGCTTTTGGCCGTAGTGGTGGGGTTATTTCTCAGCTCATGGTCAAA
+
CCCCCCCCCCC;CCCCCCCCC-CCCCCCCCCCCCCCCCCCC-CC-CCCCC
@VH00294:10:AAAWTLCHV:2:2510:16243:13628 1:N:0:ATTGCGTG+GTTATGGC

+

@VH00294:10:AAAWTLCHV:2:2510:65513:13628 1:N:0:ATTGCGTG+GTTATGGC
ATCCAAAACTTTCAAATAAGGCAAAAATACTGGTACATCTTTAAAATATCT
@Caffenicotiak
Copy link

Hey, I had this problem with one of the older versions, there was an open issue for it before it was fixed in the latest build (I'll search and link to the respective issue later), did you use the newest version of fastp (0.23.4)? That definitively solved that problem for me (now I'm running into a different one...).

@gdmdxl
Copy link
gdmdxl commented Dec 8, 2023

I had this problem，too. I think my files may have been corrupted during the transfer，because the file is large and md5 is different. I change another correct file. The problem is solved.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
3 participants
@Caffenicotiak @phucty @gdmdxl