[go: nahoru, domu]
Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

rRNA or mtRNA sequences are detected as adapter sequences? #171

Open
wisense opened this issue Jul 16, 2019 · 1 comment
Open

rRNA or mtRNA sequences are detected as adapter sequences? #171

wisense opened this issue Jul 16, 2019 · 1 comment

Comments

@wisense
Copy link
wisense commented Jul 16, 2019

Hi, developer

I used fastp with some RNA-seq data, and found the detected adapter sequences are identical to some rRNA or mtRNA sequences.

For example:
Detecting adapter sequence for read1...
GTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATA
Detecting adapter sequence for read2...
CAAACTCATGCATATCACATAGTTAATCCAAGTCCATGACCATTAACTGGAGCCTTTTCA

When I run blast with these sequences, it says these sequences are 100% identical to mouse mtRNA.

It's that means the RNA-seq sample contain a lot of rRNA and mtRNA? Should I trim these sequences before mapping?
@sfchen
Copy link
Member
sfchen commented Jul 16, 2019

It's normal that RNA-seq data has rRNA.

I think you can disable --detect_adapter_for_PE, since most adapters will be trimmed by PE overlap detection.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
2 participants
@wisense @sfchen