I have paired end fastq file from mgi sequencer using pcr free protocol.
fastp --fix_mgi_id -w 16 --adapter_sequence AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA --adapter_sequence_r2 AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG -i 1.fq.gz -I 2.fq.gz -o fastp_1.fq.gz -O fastp_2.fq.gz -j fastp.json -h fastp.html
I explicitly mentioned adapters which are used in the experiment in the fastp command.
The result for adapters look like this, can you comment on what this indicates?