[go: nahoru, domu]

Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

CPAN install failure "unknown option mafft" #169

Closed
tseemann opened this issue Aug 3, 2015 · 1 comment
Closed

CPAN install failure "unknown option mafft" #169

tseemann opened this issue Aug 3, 2015 · 1 comment
Labels

Comments

@tseemann
Copy link
Contributor
tseemann commented Aug 3, 2015

Mafft is installed and in PATH.
I deleted the original bin/roary from previous install too.
It looks like the FASTA file comparison fails - lower case vs uppercase?

t/Bio/Roary/CommandLine/QueryRoary.t .................... ok
t/Bio/Roary/CommandLine/Roary.t ......................... 46/? Unknown option: mafft
Unknown option: mafft
Unknown option: mafft
Unknown option: mafft
t/Bio/Roary/CommandLine/Roary.t ......................... 48/?
#   Failed test 'Actual and expected output match for '-j Local --dont_delete_files --dont_split_groups  --output_multifasta_files --mafft --dont_delete_files t/data/real_data_1.gff t/data/real_data_2.gff''
#   at t/lib/TestHelper.pm line 75.
# +---+--------------------------------------------------------------+--------------------------------------------------------------+
# |   |Got                                                           |Expected                                                      |
# | Ln|                                                              |                                                              |
# +---+--------------------------------------------------------------+--------------------------------------------------------------+
# |  1|>11111_1#11_04119                                             |>11111_1#11_04119
# *  2|ATGAATAAAACAACTGAGTATATTGACGCACTGCTGCTTTCTGAACGTGAGAAAGCGGCA  |atgaataaaacaactgagtatattgacgcactgctgctttctgaacgtgagaaagcggca  *```
Test Summary Report
-------------------
t/Bio/Roary/CommandLine/Roary.t                       (Wstat: 256 Tests: 50 Failed: 1)
  Failed test:  49
  Non-zero exit status: 1
Files=48, Tests=704, 140 wallclock secs ( 0.17 usr  0.05 sys + 73.77 cusr 26.66 csys = 100.65 CPU)
Result: FAIL
Failed 1/48 test programs. 1/704 subtests failed.
make: *** [test_dynamic] Error 255
  AJPAGE/Bio-Roary-3.2.4.tar.gz
  /bin/make test -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
  reports AJPAGE/Bio-Roary-3.2.4.tar.gz
Stopping: 'install' failed for 'Bio::Roary'.
Failed during this command:
 AJPAGE/Bio-Roary-3.2.4.tar.gz                : make_test NO
@andrewjpage
Copy link
Member

It should be fixed in version https://github.com/sanger-pathogens/Roary/tree/v3.2.8

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
Projects
None yet
Development

No branches or pull requests

2 participants