# Compile
git clone https://github.com/lh3/ropebwt3
cd ropebwt3
make # use "make omp=0" if your compiler doesn't suport OpenMP
# Toy examples
echo -e 'AGG\nAGC' | ./ropebwt3 build -LR -
echo TGAACTCTACACAACATATTTTGTCACCAAG | ./ropebwt3 build -Lbo idx.fmr -
echo ACTCTACACAAgATATTTTGTC | ./ropebwt3 match -Ll10 idx.fmr -
# Download the BWT of a human pangenome consisting of 100 haplotypes on both strands
wget -O human100.fmr.gz https://zenodo.org/records/11533211/files/human100.fmr.gz?download=1
gzip -d human100.fmr.gz # decompress
./ropebwt build -i human100.fmr -do human100.fmd # not required but recommended
# Count super-maximal exact matches (no contig positions)
echo CTCCAGTTGACACAAAATAGtCTACGAAAGTGGCTTTAACAT | ./ropebwt3 match -L human100.fmd -l20 -
# Retrieve chrM of CHM13. It is the 25th sequence during construction. 48=(25-1)*2
./ropebwt3 get human100.fmd 48 > CHM13-chrM.fa
Ropebwt3 constructs the BWT of a large DNA sequence set and finds super-maximal exact matches of a query sequence against the BWT. It is optimized for repetitive sequences such as a pangenome or sequence reads at high coverage. It can incrementally add new sequences to an existing BWT and is one of the few methods that can construct the double-strand BWT of 100 human genomes or 315k E. coli genomes using reasonable resources (see Performance below). This BWT can be downloaded from Zenodo.
Ropebwt3 largely replaces ropebwt2 and works better for long sequences such as chromsomes and assembled contigs. It additionally includes functionality in fermi2 such as counting and matching.
Ropebwt3 is mostly a research project I use to understand the performance of BWT construction. It may also be useful if you want to get the occurrence of a string of arbitrary length, or count long matches against a large pangenome.
Ropebwt3 implements three algorithms for BWT construction. For the best performance, you need to choose an algorithm based on the input date types.
-
If you are not sure, use the general command line
ropebwt3 build -t24 -bo bwt.fmr file1.fa file2.fa filen.fa
You can also append another file to an existing index
ropebwt3 build -t24 -bo bwt-new.fmr -i bwt-old.fmr filex.fa
-
For a set of large genomes (e.g. a human pangenome), you may generate the BWT of each individual genome on a cluster and merge them togather. This parallelizes sub-BWT construction and speeds up the overall process.
ropebwt3 build -t8 -bo genome1.fmr genome1.fa.gz ropebwt3 build -t8 -bo genome2.fmr genome2.fa.gz ropebwt3 build -t8 -bo genomen.fmr genomen.fa.gz ropebwt3 merge -t24 -bo bwt.fmr genome1.fmr genome2.fmr genomen.fmr
-
For a set of small genomes, it is better to concatenate them together:
cat file1.fa file2.fa filen.fa | ropebwt3 build -t24 -m2g -bo bwt.fmr -
-
For short reads, use the ropebwt2 algorithm and enable the RCLO sorting:
ropebwt3 build -r -bo bwt.fmr reads.fq.gz
-
Use grlBWT, which is faster than ropebwt3 for large pangenomes:
ropebwt3 fa2line genome1.fa genome2.fa genomen.fa > all.txt grlbwt-cli all.txt -t 32 -T . -o bwt.grl grl2plain bwt.rl_bwt bwt.txt ropebwt3 plain2fmd -o bwt.fmd bwt.txt
These command lines construct a BWT for both strands of the input sequences.
You can skip the reverse strand by adding option -R
.
When you use the build
command for one genome, the peak memory by default is
-m
.
The peak memory for the merge
command is
If you provide multiple files on a build
command line, ropebwt3 internally
will run build
on each input file and then incrementally merge each
individual BWT to the final BWT. The peak memory will be the higher one between
the build
step and the merge
step.
Ropebwt3 uses two binary formats to store run-length encoded BWTs: the ropebwt2 FMR format and the fermi FMD format. The FMR format is dynamic in that you can add new sequences or merge BWTs to an existing FMR file. The same BWT does not necessarily lead to the same FMR. The FMD format is simpler in structure, faster to load, smaller in memory and can be memory-mapped. The two formats can be used interchangeably in ropebwt3, but it is recommended to use FMR for BWT construction and FMD for finding exact matches. You can explicitly convert between the two formats with:
ropebwt3 build -i in.fmd -bo out.fmr
ropebwt3 build -i in.fmr -do out.fmd
A maximal exact match (MEM) is an exact alignment between the index and a query that cannot be extended in either direction. A super MEM (SMEM) is a MEM that is not contained in any other MEM on the query sequence. You can find the SMEMs of a query provided that your BWT is constructed from both strands of sequences.
ropebwt3 match -t4 bwt.fmd query.fa > matches.bed
In the output, the first three columns give the query sequence name, start and end of a match and the fourth column gives the number of hits. As of now, ropebwt3 does not report the locations of matches.
If searching for SMEMs is slow, you may add option -g
to look for greedy MEMs
which are found by a forward search followed by a backward search from the
furthest forward search. Similar to SMEMs, greedy MEMs are MEMs and are not
contained in each other on the query sequence. However, greedy MEMs are not
always SMEMs. They are approximate.
If the BWT only contains one strand, you can use the suffix
command to find
the longest matching suffix of a query sequence:
ropebwt3 suffix bwt.fmd query.fa > suffixes.bed
You can encode and decode a FMD file with rld0.h and rld0.c. The two-file library also supports the rank() operator. Here is a small program to convert FMD to plain text:
// compile with "gcc -O3 rld0.c this.c"; run with "./a.out idx.fmd > out.txt"
#include <stdio.h>
#include "rld0.h"
int main(int argc, char *argv[]) {
if (argc < 2) return 1;
rld_t *e = rld_restore(argv[1]);
rlditr_t ei; // iterator
rld_itr_init(e, &ei, 0);
int c;
int64_t i, l;
while ((l = rld_dec(e, &ei, &c, 0)) > 0)
for (i = 0; i < l; ++i) putchar("\nACGTN"[c]);
rld_destroy(e);
return 0;
}
and to count a string in an FMD file:
// compile with "gcc -O3 rld0.c this.c"; run with "./a.out idx.fmd AGCATAG"
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include "rld0.h"
int main(int argc, char *argv[]) {
if (argc < 3) return 1;
rld_t *e = rld_restore(argv[1]);
uint64_t k = 0, l = e->cnt[6], ok[6], ol[6];
const char *s = argv[2];
int i, len = strlen(s);
for (i = len - 1; i >= 0; --i) { // backward search
int c = s[i];
c = c=='A'?1:c=='C'?2:c=='G'?3:c=='T'?4:5;
rld_rank2a(e, k, l, ok, ol);
k = e->cnt[c] + ok[c];
l = e->cnt[c] + ol[c];
if (k == l) break;
}
printf("%ld\n", (long)(l - k));
rld_destroy(e);
return 0;
}
Ropebwt3 effectively appends a distinct sentinel to each string in the string set such that we never need to compare suffixes beyond sentinels. This is an essential assumption behind ropebwt3. Ropebwt3 would become much slower if you concatenate all strings without sentinels.
Like ropebwt2, ropebwt3 uses a B+-tree to store a run-length encoded BWT. It can either insert sequences or merge BWTs into the B+-tree. The sequence insertion algorithm is identical to ropebwt2. Please see its paper for details.
BWT merging can be done in several equivalent ways and has been
described in multiple papers. More exactly in ropebwt3, suppose we want to
append the
and update
until
A classical BWT only supports backward search but if a BWT contains both strands of DNA sequences, it will support both forward and backward searches. And with search in both directions, it is possible to find SMEMs. Please see the fermi paper for details.
The following table shows the time to construct the BWT for two datasets: 100 human genomes assembled with long reads and 315k E. coli genomes from AllTheBacteria v0.2. In the leftmost column in the table, the numbers in parentheses indicates the number of symbols in the input multiplied by two strands.
Dataset | Metric | rb3 bulid | rb3 merge | grlBWT | pfp-thresholds |
---|---|---|---|---|---|
human100 | Elapsed time (h) | 33.7 | 24.2 | 8.3 | 51.7 |
(300Gb×2) | CPU time (h) | 803.6 | 757.2 | 29.6 | 51.5 |
Peak memory (GB) | 82.3 | 70.7 | 84.8 | 788.1 | |
ecoli315k | Elapsed time (h) | 128.7 | |||
(1.6Tb×2) | CPU time (h) | 3826.8 | |||
Peak memory (GB) | 20.5 |
For human100, the following methods were evaluated:
-
rb3 build
: construct BWT from input FASTA files withropebwt3 build -t48
(using up to 48 threads). This is the only method here that does not use working disk space. -
rb3 merge
: merge 100 BWTs constructed from 100 FASTA files, respectively. Constructing the BWT for one human genome takes around 10 minutes, which is not counted in the table. -
grlBWT
: construct BWT using grlBWT. We need to concatenate all input FASTA files and convert them to the one-sequence-per-line format withropebwt3 fa2line
. Conversion time is not counted. -
pfp-thresholds
: launched via the Movi indexing script. It was run on a slower machine with more RAM. The time forprepare_ref
is not counted, either.
grlBWT is clearly the winner for BWT construction and it also works for non-DNA alphabet. Ropebwt3 has acceptable performance and its support of incremental build may be helpful for large datasets.
-
The "match" command of ropebwt3 only counts the number of hits but does not report the locations of the hits. Fermi2 already supports such functionality using standard sampled suffix array but it needs to be reworked.
-
The "merge" command can be accelerated by 10-30% with a more efficient data structure but grlBWT will be faster anyway.