CN102839188B - Homonymous tandem co-expression bi-color fluorescent protein report gene vector - Google Patents

Abstract

The invention relates to a homonymous tandem co-expression bi-color fluorescent protein report gene vector pDsRed2-MCS-EGFP. On the basis of vectors pIRES2-EGFP, the homonymous tandem co-expression bi-color fluorescent protein report gene vector pDsRed2-MCS-EGFP is prepared by obtaining a vector skeleton pDeltaSG of deleted IRES(internal ribosome entry site) and EGFP(enhanced green fluorescent protein) sequences through a polymerase chain reaction (PCR); constructing the T vectors to clone psT-DeltaSG; performing enzyme digestion on the psT-DeltaSG, and connecting the psT-DeltaSG with fluorescent protein report genes DsRed2 and the EGFP which are synchronously subjected to enzyme digestion and carry additional optimized MCS (multiple cloning site) sequences; and performing subcloning. The target DNA sequences to be analyzed are directionally cloned into an MCS area of pDsRed2-MCS-EGFP, obtained recombinant plasmids transfect corresponding host cells, and the background of DsRed2 expresses and indicates the transfection efficiency. The expression of EGFP depends on the activity of target DNA sequences of the MCS area, and the expression and the expression quantity are used for indexing whether the target DNA sequences have corresponding biological activity or not and indexing the magnitude of the biological activity. The optimized MCS sequences are suitable for wider range of gene cloning operation; the detection aging ranges of the DsRed2 and the EGFP expression are wide, are mutually independent and are mutually characterized; and the imaging effect is clear and bright, so that the experimental operation is more convenient, and the results are more persuasive.

Description

Series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector

Technical field

Whether the present invention relates to series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector, be for the identification of external source target DNA fragment, to have to start to transcribe or the vector plasmid of initial interpretative function.

Background technology

The transgene carrier that contains selection markers tool in genetically engineered has been widely used.Common transgene carrier includes one or more selection markers or reporter gene, to facilitate inserting the screening and identification of extraneous nucleotide fragment recombinant plasmid.Wherein to have that biological activity is stable, signal specificity strong, effective active is held time long, convenient detects and disturb the features such as little to external source destination gene expression is active for the expression product of fluorescence protein gene in viable cell, so often utilize the expression of fluorescence protein gene to carry out the function of Study of Exogenous nucleotide fragments.Generally, in same Reporter gene vector, only contain a fluorescence protein gene, target DNA fragment is cloned into N end or the C end of fluorescence protein gene, the corresponding host cell of Transfected Recombinant Plasmid building, by detecting the expression of fluorescin, can judge whether object nucleic acid fragment has corresponding function, but be difficult to the transfection efficiency and the biological function of judging target DNA of synchronous reflection restructuring reporter plasmid.

Summary of the invention

The object of this invention is to provide a kind of series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector pDsRed2-MCS-EGFP, within on 07 06th, 2012, send China Committee for Culture Collection of Microorganisms's common micro-organisms center that is hidden in, address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Classification And Nomenclature colon bacillus (Escherichia coli), preserving number CGMCC 6320.

The present invention builds the technical scheme that the Reporter gene vector of series aiding connection coexpression Two Colour Fluorescence albumen adopts: utilize gene clone technology, between Bgl II site after parent vector pIRES2-EGFP promotor pCMV and SV40polyA sequence, replace into following DNA sequence dna: from 5` to 3` direction, insert successively red fluorescent protein gene DsRed2, the polyclone restriction enzyme site MCS of optimum combination (comprises Sal I, Spe I, Sca I, Pvu I, Nhe I, Mlu I, EcoR I, Xba I, BamH I, Sac II, Sac I, Sma I and EcoR V, wherein Nhe I is non-mono-clonal site), green fluorescence protein gene EGFP and Xho I site sequence (as the 609-2085nt in SEQNO.1), obtain the novel Reporter gene vector plasmid pDsRed2-MCS-EGFP of the series aiding connection coexpression Two Colour Fluorescence albumen of nucleotide sequence as shown in SEQNO.1 (1-5408nt).

The DNA molecular of the Reporter gene vector of described series aiding connection coexpression Two Colour Fluorescence albumen also belongs to protection scope of the present invention.

The transgenosis recombinant bacterium or the cell that contain described carrier molecule, described restructuring Reporter gene vector also belong to protection scope of the present invention.

Series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector of the present invention possesses through simple operationss such as direct enzyme cutting, the restructuring reporter plasmid that connects structure insertion target DNA and transfectional cells, just can insert the bioactive function of target DNA sequence for analysis and identification; By pCMV, started in the polycistronic mRNA transcribe, the expression of upstream red fluorescent protein indication transfection efficiency, the expression of downstream green fluorescent protein whether and output reflection target DNA sequence whether there is corresponding biological activity and active height thereof.

Accompanying drawing explanation

The structure collection of illustrative plates of the two fluorescent protein report gene carrier pDsRed2-MCS-EGFP of Fig. 1 series aiding connection coexpression.

Pcr amplification and the clone identification electrophoretogram of Fig. 2 carrier framework p Δ SG.

Fig. 3 builds the electrophoretogram of the two fluorescent protein report gene carrier pDsRed2-MCS-EGFP of series aiding connection coexpression.

The recombinate enzyme of reporter plasmid pDsRed2-LTR-EGFP of Fig. 4 is cut evaluation electrophoretogram.

The fluoroscopic examination result of each plasmid transfection Chinese hamster ovary celI of Fig. 5.

Embodiment

In following embodiment, if no special instructions, method therefor is conventional gene clone method, and agents useful for same all can be buied through commercial sources.

Embodiment

1. build series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector pDsRed2-MCS-EGFP

(1) pcr amplification and the clone of carrier framework p Δ SG

At carrier pIRES2-EGFP (PT3267-5, Clontech) on basis, primer p Δ SG F, the p Δ SG R amplification disappearance IRES that design contains linker sequence and the carrier framework p Δ SG (comprising pCMV, PUC ori, Kan/Neo, SV40polyA function or gene order) of EGFP gene fragment.

P Δ SG F:5 '-CGCCTCGAGTCTAGATCATAATCAGCCATACC-3 ', (recognition site that contains XhoI, XbaI);

P Δ SG R:5 '-CCGGATATCGAATTCGAAGCTTGAGC-3 ', (recognition site that contains EcoR I, EcoR V).

The composition of 25 μ l reaction systems is: distilled water 15.0 μ l, Ex Taq 10 * Buffer 2.5 μ l, dNTPs 2.0 μ l, MgCl ₂1.5 μ l, p Δ SG F1.0 μ l, p Δ SG R 1.0 μ l, pIRES2-EGFPTE solution 1.0 μ l, ExTaq 1.0 μ l.

Pcr amplification condition is 95 ℃ of 5min; 95 ℃ of 50sec, 55 ℃ of 50sec, 72 ℃ of 5min, totally 32 circulations; After fully extending finally by 72 ℃ of 10min, be cooled to 4 ℃ of preservations.

PCR product is the p Δ SG PCR product of 3975bp through the separated size of 0.8% agarose gel electrophoresis, cuts glue and builds recombinant clone psT-Δ SG with being connected with pMD 18-TSimple Vector after receiving.Through routine, transform through CaCl ₂the DH5 α competent cell of preparation, coating is containing the LB solid plate of Ampicillin, 37 ℃ of incubated overnight.

Then choose single bacterium colony of dull and stereotyped upper advantage resistance growth, with primer p Δ SG F, p Δ SG R, be bacterium colony PCR and detect.The positive clone's bacterium colony of Preliminary detection is through choosing bacterium, containing the amplification Hou Song commercial company order-checking of spending the night in the LB liquid nutrient medium of Ampicillin.The plasmid that extracts clone's sample that result is correct carries out EcoR I, XhoI double digestion and the reaction of Bgl II single endonuclease digestion, identifies vector plasmid psT-Δ SG.PsT-Δ SG goes out 2710bp and 3957bp two bands through EcoRI and XhoI double digestion, goes out a band of 6667bp through Bgl II single endonuclease digestion.

The electrophoresis result of clone, evaluation psT-Δ SG as shown in Figure 2.In Fig. 2,1. the PCR product of amplification p Δ SG, amplification, 3.psT-Δ SG that 2. bacterium colony PCR identifies p Δ SG through EcoR I and XhoI double digestion product, 4.psT-Δ SG through Bgl II single endonuclease digestion product, 5.DNA MarkerDL15000.

(2) build series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector plasmid pDsRed2-MCS-EGFP

On the basis of carrier pDsRed2-Cl (PT3603-5, Clontech), design primer DsRed2F, the DsRed2R red fluorescent protein gene DsRed2 (723nt) that increases.

DsRed2F:5`-CAGATCTACCATGGCCTCCTCCGAGAAC-3`, (containing Bgl II recognition site); DsRed2R:5`-GAATTCACGCGTGCTAGCGATCGAGTACTAGTCGACTACAGGAAC AGGTGGTGGCGGC-3`, (contain Sal I, Spe I, ScaI, PvuI,

mluI and EcoRI recognition site, wherein

not mono-clonal restriction enzyme site).

PCR reaction system is: distilled water 15.0 μ l, ExTaq 10 * Buffer2.5 μ l, dNTPs 2.0 μ l, MgCl ₂1.5 μ l, DsRed2F 1.0 μ l, DsRed2R 1.0 μ l, pDsRed2-C1TE solution 1.0 μ l, Ex Taq 1.0 μ l.

Pcr amplification condition is 95 ℃ of 5min; 95 ℃ of 50sec, 55 ℃ of 50sec, 72 ℃ of 50sec, totally 32 circulations; After fully extending finally by 72 ℃ of 10min, be cooled to 4 ℃ of preservations.

PCR product is separated through 0.8% agarose gel electrophoresis, cuts after glue reclaims and is connected with pMD 18-T Simple Vector.Connecting product transforms through CaCl through routine ₂the DH5 α competent cell of preparation, coating is containing the LB solid plate of Ampicillin, 37 ℃ of incubated overnight.

Then with primer DsRed2F, DsRed2R, be bacterium colony PCR and detect, positive colony bacterium colony is through checking order containing Ampicillin LB liquid nutrient medium amplification Hou Song commercial company.The plasmid that extracts clone's sample that result is correct carries out Bgl II and EcoR I double digestion, identifies recombinant plasmid psT-DsRed2.

On the basis of carrier pIRES2-EGFP (PT3267-5, Clontech), design primer EGFP F, the EGFP R green fluorescence protein gene EGFP (766nt) that increases.

EGFP F:5`-GAATTCTAGAGGATCCGCGGAGCTCCCGGGATATCATGGTGAGCAAGGGCG AG-3, (containing EcoR I, Xba I, BamHI, Sac II, Sac I, Sma I and EcoR V recognition site);

EGFPR:5`-CGCGGCTCGAGTTACTTGTACAGCTCGTCCATGC-3`, (containing Xho I recognition site).

PCR reaction system is: distilled water 15.0 μ l, Ex Taq 10 * Buffer 2.5 μ l, dNTPs 2.0 μ l, MgCl ₂1.5 μ l, EGFP F 1.0 μ l, EGFP R 1.0 μ l, plRES2-EGFP TE solution 1.0 μ l, Ex Taq 1.0 μ l.

Pcr amplification condition is 95 ℃ of 5min; 95 ℃ of 50sec, 55 ℃ of 50sec, 72 ℃ of 50sec, totally 32 circulations; After fully extending finally by 72 ℃ of 10min, be cooled to 4 ℃ of preservations.

PCR product is separated through 0.8% agarose gel electrophoresis, cuts after glue reclaims and is connected with pMD 18-T Simple Vector.Connecting product transforms through CaCl through routine ₂the DH5 α competent cell of preparation, coating is containing the LB solid plate of Ampicillin, 37 ℃ of incubated overnight.

Then with primer EGFP F, EGFP R, be bacterium colony PCR and detect, positive colony bacterium colony is through checking order containing Ampicillin LB liquid nutrient medium amplification Hou Song commercial company.The plasmid that extracts clone's sample that result is correct carries out EcoR I, the reaction of Xho I double digestion, identifies recombinant plasmid psT-EGFP.

Get the carrier segments p Δ SG of vector plasmid psT-Δ SG after Bgl II, Xho I double digestion _bg-Xh, psT-DsRed2 is through Bgl II, EcoR I double digestion object fragment DsRed2 _bg-Ei, and psT-EGFP is through EcoR I, Xho I double digestion object fragment EGFP _ei-Xh, use T ₄ligase enzyme connects.The reaction system of 10 μ l is: p Δ SG _bg-Xh2.0 μ l, DsRed2 _bg-Ei3.0 μ l, EGFP _ei-Xh3.0 μ l, 10 * T ₄buffer 1.0 μ l, T ₄ligase 1.0 μ l.Ligation condition is 16 ℃ of 4h, then goes to 4 ℃ of preservations.

Connect the conventional conversion of product through CaCl ₂the DH5 α competent cell of preparation, coating is containing the LB solid plate of Kanamycin, 37 ℃ of incubated overnight.Then with primer EGFP F, EGFP R and DsRed2F, DsRed2R, do respectively bacterium colony PCR screening, the clone's bacterium colony being all positive for twice is containing incubated overnight in the LB liquid nutrient medium of Kanamycin through choosing bacterium, extract plasmid and carry out respectively Bgl II and Sal I, Bgl II and EcoRI, EcoR I and Xho I and EcoR V and the reaction of Xho I double digestion, identify restructuring series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector plasmid pDsRed2-MCS-EGFP; Its carrier collection of illustrative plates as shown in Figure 1.PDsRed2-MCS-EGFP goes out 4722bp and 686bp two bands, through Bgl II, EcoR I double digestion, goes out 4692bp and 716bp two bands, through EcoR I, Xho I double digestion, goes out size through Bgl II, Sal I double digestion is 4653bp and 755bp two bands, through EcoR V, Xho I double digestion, go out size is 4682bp and 726bp two bands; Its enzyme is cut and is identified agarose gel electrophoresis result as shown in Figure 3.In Fig. 3,1:Bgl II, Sal I double digestion result, 2:Bgl II, EcoRI double digestion result, 3:EcoR I, Xho I double digestion result, 4:EcoR V, the result of Xho I double digestion, 5:DNA Marker DL15000.

2. build the restructuring two-color fluorescence report gene plasmid pDsRed2-LTR-EGFP that inserts REV LTR

Get the recombinant plasmid psT-LTR and two fluorescent protein report gene vector plasmid pDsRed2-MCS-EGFP object fragment LTR after EcoR I, EcoR V double digestion equally that recombinates that carry REV LTR _i-v(550nt), pDsRed2-MCS-EGFP _i-v, use T ₄ligase enzyme connects.The reaction system of 10 μ l is: 10 * T ₄buffer 1.0 μ l, pDsRed2-MCS-EGFP _i-v1.0 μ l, LTR _i-v7.0 μ l, T ₄ligase 1.0 μ l.Ligation condition is 16 ℃ of 4h, then goes to 4 ℃ of preservations.

Connect the conventional conversion of product through CaCl ₂the DH5 α competent cell of preparation, coating is containing the LB solid plate substratum of Kanamycin, 37 ℃ of incubated overnight.Then picking advantage resistance mono-clonal bacterium colony incubated overnight, extracts the double digestion reaction that plasmid carries out respectively Bgl II and Sal I, EcoR I and EcoR V, EcoR V and Xho I combination, identifies recombinant plasmid pDsRed2-LTR-EGFP.PDsRed2-LTR-EGFP is through Bgl II, Sal I cuts out 5272bp and 686bp two bands, through EcoR I, EcoR V cuts out 5402bp and 556bp two bands, through EcoR V, Xho I cuts out 5232bp and 726bp two bands, through Bgl II, EcoR I, EcoRV, Xho I tetra-enzymes cut out 3937bp (carrier segments), 716bp (DsRed2), 556bp (LTR) and 726bp (EGFP) four bands, but because both sizes of 716bp and 726bp differ very little, therefore can not obviously be separated in the short period of time during electrophoresis, and overlap into width, expand, the band that brightness almost doubles, its agarose gel electrophoresis result as shown in Figure 4.In Fig. 4, the result of the result of the result of 1:BglII, SalI double digestion, 2:EcoRI, EcoRV double digestion, 3:EcoRV, Xho I double digestion, 4 and 5:Bgl II, EcoR I, EcoR V, Xho I tetra-the enzymes result, the 6:DNA Marker 15000 that cut.

3. cell transfecting

Get each approximately 0.8 μ g of parent vector Plasmid pIRES 2-EGFP, pDsRed2-C1 and recombinant plasmid pDsRed2-MCS-EGFP, pDsRed2-LTR-EGFP, with reference to < < molecular cloning (third edition) > > P1276-1281, with Lipofectamine transfection, grown up to the Chinese hamster ovary celI of individual layer.After 24h, transfectional cell is placed in to the expression that detects green and red fluorescent protein under fluorescent microscope.

Fluoroscopic examination result as shown in Figure 5, in the cell of parent vector plasmid pDsRed2-C1 transfection, only have red fluorescent protein to express (Fig. 5, B), in the cell of pIRES2-EGFP transfection, only has egfp expression (Fig. 5, C), in the cell of series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector plasmid pDsRed2-MCS-EGFP transfection, only have red fluorescent protein to express (Fig. 5, D), MCS district is cloned in the cell of restructuring series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector plasmid pDsRed2-LTR-EGFP transfection of REV LTR, green and red fluorescent protein has all obtained high efficient expression (Fig. 5, E, F), blank Chinese hamster ovary celI with untransfected compares (Fig. 5, A) simultaneously.

In Fig. 5, A: the blank Chinese hamster ovary celI of untransfected, the Chinese hamster ovary celI of B:pDsRed2-C1 transfection, the Chinese hamster ovary celI of C:pIRES2-EGFP transfection, the Chinese hamster ovary celI of D:pDsRed2-MCS-EGFP transfection, the Chinese hamster ovary celI of E and F:pDsRed2-LTR-EGFP transfection.

<110> Taishan Hospital

<120> series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector pDsRed2-MCS-EGFP

<141>2012-08-18

<160>1-5408

<210>SEQ NO.1

<211>5408

<212>DNA

<213> artificial sequence

<220>

<400>1

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 600

ccggactcag atctaccatg gcctcctccg agaacgtcat caccgagttc atgcgcttca 660

aggtgcgcat ggagggcacc gtgaacggcc acgagttcga gatcgagggc gagggcgagg 720

gccgccccta cgagggccac aacaccgtga agctgaaggt gaccaagggc ggccccctgc 780

ccttcgcctg ggacatcctg tccccccagt tccagtacgg ctccaaggtg tacgtgaagc 840

accccgccga catccccgac tacaagaagc tgtccttccc cgagggcttc aagtgggagc 900

gcgtgatgaa cttcgaggac ggcggcgtgg cgaccgtgac ccaggactcc tccctgcagg 960

acggctgctt catctacaag gtgaagttca tcggcgtgaa cttcccctcc gacggccccg 1020

tgatgcagaa gaagaccatg ggctgggagg cctccaccga gcgcctgtac ccccgcgacg 1080

gcgtgctgaa gggcgagacc cacaaggccc tgaagctgaa ggacggcggc cactacctgg 1140

tggagttcaa gtccatctac atggccaaga agcccgtgca gctgcccggc tactactacg 1200

tggacgccaa gctggacatc acctcccaca acgaggacta caccatcgtg gagcagtacg 1260

agcgcaccga gggccgccac cacctgttcc tgtagtcgac tagtactcga tcgctagcac 1320

gcgtgaattc tagaggatcc gcggagctcc cgggatatca tggtgagcaa gggcgaggag 1380

ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa cggccacaag 1440

ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac cctgaagttc 1500

atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cctgacctac 1560

ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc 1620

gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac 1680

aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag 1740

ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac 1800

agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt gaacttcaag 1860

atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca gcagaacacc 1920

cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac ccagtccgcc 1980

ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt cgtgaccgcc 2040

gccgggatca ctctcggcat ggacgagctg tacaagtaac tcgagtctag atcataatca 2100

gccataccac atttgtagag gttttacttg ctttaaaaaa cctcccacac ctccccctga 2160

acctgaaaca taaaatgaat gcaattgttg ttgttaactt gtttattgca gcttataatg 2220

gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt 2280

ctagttgtgg tttgtccaaa ctcatcaatg tatcttaagg cgtaaattgt aagcgttaat 2340

attttgttaa aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc 2400

gaaatcggca aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt 2460

ccagtttgga acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa 2520

accgtctatc agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg 2580

tcgaggtgcc gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga 2640

cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct 2700

agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat 2760

gcgccgctac agggcgcgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 2820

tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 2880

atgcttcaat aatattgaaa aaggaagagt cctgaggcgg aaagaaccag ctgtggaatg 2940

tgtgtcagtt agggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca 3000

tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa 3060

gtatgcaaag catgcatctc aattagtcag caaccatagt cccgccccta actccgccca 3120

tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt 3180

ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag tagtgaggag 3240

gcttttttgg aggcctaggc ttttgcaaag atcgatcaag agacaggatg aggatcgttt 3300

cgcatgattg aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta 3360

ttcggctatg actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg 3420

tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa 3480

ctgcaagacg aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct 3540

gtgctcgacg ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg 3600

caggatctcc tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca 3660

atgcggcggc tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat 3720

cgcatcgagc gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac 3780

gaagagcatc aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc 3840

gacggcgagg atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa 3900

aatggccgct tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag 3960

gacatagcgt tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc 4020

ttcctcgtgc tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt 4080

cttgacgagt tcttctgagc gggactctgg ggttcgaaat gaccgaccaa gcgacgccca 4140

acctgccatc acgagatttc gattccaccg ccgccttcta tgaaaggttg ggcttcggaa 4200

tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg ctggagttct 4260

tcgcccaccc tagggggagg ctaactgaaa cacggaagga gacaataccg gaaggaaccc 4320

gcgctatgac ggcaataaaa agacagaata aaacgcacgg tgttgggtcg tttgttcata 4380

aacgcggggt tcggtcccag ggctggcact ctgtcgatac cccaccgaga ccccattggg 4440

gccaatacgc ccgcgtttct tccttttccc caccccaccc cccaagttcg ggtgaaggcc 4500

cagggctcgc agccaacgtc ggggcggcag gccctgccat agcctcaggt tactcatata 4560

tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt 4620

ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc 4680

ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct 4740

tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa 4800

ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag 4860

tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc 4920

tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg 4980

actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca 5040

cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat 5100

gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg 5160

tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc 5220

ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc 5280

ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc 5340

cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg 5400

ccatgcat 5408

Claims (8)

1. a DNA molecular, is characterized in that: can series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector plasmid pDsRed2-MCS-EGFP through what optimize the series connection of MCS sequence, there is the DNA sequence dna of 609-2085nt in SEQ NO.1.

2. the construction process that contains Reporter gene vector plasmid described in claim 1, concrete steps are as follows:

A. pcr amplification and the clone of carrier framework p Δ SG: take carrier pIRES2-EGFP as template, design contain Iinker sequence primer with ExTaq the carrier framework through its 1986nt-614nt of PCR reaction amplification, PCR product is connected with pMD18-T Simple Vector after electrophoretic separation, recovery, advantage resistance growth bacterium colony after conversion is cut evaluation through bacterium colony PCR screening and enzyme, builds plasmid psT-Δ SG;

The pcr amplification of B.DsRed2 gene order and clone: take carrier pDsRed2-C1 as template, the primer of design additional optimizations restriction enzyme site sequence is through PCR reaction amplification red fluorescent protein gene DsRed2, PCR product is connected with pMD18-T Simple Vector after electrophoretic separation, recovery, advantage resistance growth bacterium colony after conversion is cut evaluation through bacterium colony PCR screening and enzyme, builds plasmid psT-DsRed2;

The pcr amplification of C.EGFP gene order and clone: take carrier pIRES2-EGFP as template, the primer of design additional optimizations restriction enzyme site sequence is through PCR reaction amplification green fluorescence protein gene EGFP, PCR product is connected with pMD18-T Simple Vector after electrophoretic separation, recovery, advantage resistance growth bacterium colony after conversion is cut evaluation through bacterium colony PCR screening and enzyme, builds plasmid psT-EGFP;

D. build series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector pDsRed2-MCS-EGFP: get recombinant plasmid psT-Δ SG, psT-DsRed2 and the psT-EGFP corresponding double digestion object fragment p Δ SG that respectively hangs oneself _bg-Xh, DsRed2 _bg-Ei, EGFP _ei-Xh, use T simultaneously ₄ligase enzyme connects, advantage resistance growth bacterium colony use after conversion is carried out twice bacterium colony PCR screening for the primer of DsRed2, EGFP respectively, the two positive plasmids of bacterium colony through increasing, extracting that transform carry out double digestion evaluation with restriction endonuclease Sal I, EcoR I, the EcoR V combination of identification MCS inside restriction enzyme site respectively with the restriction endonuclease Bgl II, the XhoI that lay respectively at identification DsRed2, EGFP two end restriction enzyme sites again, build series aiding connection coexpression Two Colour Fluorescence albumen Reporter gene vector plasmid pDsRed2-MCS-EGFP.

3. Reporter gene vector plasmid according to claim 2, it is characterized in that: pCMV downstream is connected with the Two Colour Fluorescence albumen reporter gene sequence D sRed2-MCS-EGFP that optimizes MCS tandem expression, and the nucleotides sequence of described Reporter gene vector is classified the DNA sequence dna of the 1-5408nt in SEQ NO.1 as.

4. the transgenic cell that contains Reporter gene vector plasmid described in claim 1.

5. the transgenic cell that contains Reporter gene vector plasmid described in claim 2 or 3.

6. the recombinant bacterium that contains Reporter gene vector plasmid described in claim 1.

7. the recombinant bacterium that contains Reporter gene vector plasmid described in claim 2 or 3.

8. the application of Reporter gene vector plasmid in testing goal DNA sequence dna function described in claim 2 or 3.

Images