JP2009072062A - Method for isolating 5'-terminals of nucleic acid and its application - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for isolating the 5'-terminals of a nucleic acid originated from a biological resource in a test tube. <P>SOLUTION: This method for catching the terminals of the nucleic acid comprises (a) a process for removing the 5'-phosphate group of a non-full length RNA molecule, (b) a process for removing a capping site from a 5'-perfect RNA molecule, and adding a proper nucleic acid. The obtained modified RNA is subjected to a reverse transcription to obtain a cDNA. Thereby, the construction, tagging and sequence determination or RNA reduction of a cDNA library containing a small scale RNA are made possible. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

<Gene expression analysis>
The genome contains vital genetic information about the development and homeostasis of any organism. In order to understand biological phenomena, knowledge about how such genetic information is utilized in a cell or tissue at a given time is required. Many examples are known where the use of genetic information and associated control pathway errors have caused disease in humans or plants and animals. Therefore, there is a need for methods that allow expression profiling and annotation of identified transcripts and characterization of genetic elements controlling genetic information. Most expression studies currently use either in situ hybridization, for example microarrays, or techniques based on high-throughput sequencing of short tags, such as SAGE, CAGE, MMPS, in which case both types of experiments are , Have clear advantages over each other. However, in order to understand the control principles responsible for gene expression, it may be desirable to obtain information about genetic elements that regulate gene expression.

  Due to the limitations of DNA microarray experiments, alternative approaches based on partial sequences (tags described above) obtained from multiple mRNA samples have been used for gene discovery and expression profiling. The so-called SAGE (Serial Analysis of Gene Expression) method is known as an efficient method for obtaining partial information on the base sequence in mRNA (Velculescu V.E. Science 270, 484-487 (1995), which is hereby incorporated by reference). This method forms a DNA concatamer by linking a large number of short DNA fragments (initially about 10 bp) containing information on the base sequence at the 3 ′ end of a large number of mRNAs. decide. Recently, a recommended version of SAGE that allows cloning of longer SAGE tags, the so-called LongSAGE, has been published (Saha S. et al., Nat. Biotechnol. 20, 508-12 (2002), US Patent Application No. 20030008290, US Patent Application No. 20030049653 (all hereby incorporated by reference)). The SAGE method is currently widely used as an important method for analyzing genes expressed in specific cells, tissues or organisms; and the SAGE tag is a public domain, eg http: // cgap . nci. nih. Gov / SAGE, available for reference.

U.S. Patent No. 6,352,828; U.S. Patent No. 6,306,597; U.S. Patent No. 6,280,935; U.S. Patent No. 6,265,163; U.S. Patent No. 5,695,934 ( all, by which is incorporated herein by reference), massively parallel signatures sequencing (M assively P arallel S ignature S equencing) or as "MPSS" is displayed, the high-throughput sequencing of short sequence tags Disclose a different approach for. Brenner S.M. Et al., Nat. Biotechnol. 18, 630-634 (2000), and Brenner S. et al. Et al., Proc. Natl. Acad. Sci. USA 97, 1655-1670 (2000) (both hereby incorporated by reference) to perform cycles with different enzymatic reactions on monolayer beads. Precisely short sequences are obtained from the 3 ′ end of the transcript in a very parallel manner. WO 03/09141 (which is hereby incorporated by reference) disclosed changes to the above approach to allow sequencing of short sequences from the 5 ′ end of the transcript.

Most of the above approaches have focused on the use of sequence tags from the 3 ′ end, but in order to obtain sequence tags from other regions of the transcript, especially from the 5 ′ end, a new approach Was developed. Such techniques are described in PCT / JP03 / 07514, and Shiraki T. et al. Et al., Proc. Natl. Acad. Sci. USA 100, 15776-15781 (2003), both of which are hereby incorporated by reference. This so-called CAGE (Cap - Analysis - gene - expression (C ap- A nalysis- G ene- E xpression)) technique, like the SAGE technology, to allow cloning into concatemers of 5 'end-specific tag, the In some cases, the CAGE tag not only allows for the detection of transcripts and their expression profiling, but also provides information on the transcription start site that allows mechanistic studies on transcriptional regulation or higher transcript annotations. The latter similar approach for cloning concatamers containing 5 'end-specific information was later described by a number of other laboratories, for example Hwang B. et al. J. et al. Et al., Proc. Natl. Acad. Sci. USA 101, 1650-1655 (2004), Hashimoto S. et al. Et al., Nat. Biotechnol. 22, 1461-1149 (2004), Zhang Z. And Dietrich F. et al. S. , Nuc. Acids Res. 33, 2838-2851 (2005), as well as Wei C.I. L. Et al., Proc. Natl. Acad. Sci. USA 101, 11701-11706 (2004), all of which are hereby incorporated by reference herein.

  All of these approaches focus on the cloning and sequencing of a single sequence tag. Thus, such an approach still has a limited feasible throughput for tag sequencing. In addition, such an approach requires a number of operational steps that can provide an argument for bias. In particular, in the amplification stage, since the amplification rate differs for each individual DNA fragment, there is a possibility of causing an artificial result and a bias in tag frequency. Recent advances in the field will pioneer new ways to obtain sequence information with much higher throughput than is currently feasible by classical techniques. Of particular interest is the Metzker M.I. L. Genome Res. 15, 1767-1776 (2005), Kling J. et al. , Nature Biotechnology 23, 1333-1335 (2005) and Shendure J. et al. Et al., Nature Review Genetics 5, 335-344 (2004), all hereby incorporated by reference herein, for the detection and sequencing of single DNA molecules. This is a new method. The present invention provides an innovative solution for DNA fragment acquisition methods for single molecule detection and sequencing that can also be used for other applications. Thus, the present invention provides a means of modifying RNA molecules in such a way that specific sequence information can be obtained at the 5 'end of the modified RNA molecule. Thus, the present invention also enables novel high-throughput sequencing techniques and their use, for example, in expression profiling. Furthermore, the present invention provides additional valuable tools for studies including, but not limited to, expression profiling studies based on 5 ′ end-specific information tags, which can be used for drug development, diagnostic agents. Or a critical component of commercial use and service, including but not limited to forensic research.

  In summary, these limitations suggest the need for selection of the 5 'end region of mRNA cDNA that may be suitable for expression profiling and other uses.

<Isolation of full-length cDNA molecule>
Analysis and cloning of the 5 ′ end of the mRNA was the basis for the preparation of full-length cDNA collections and for discovering the expression part of the genome, including protein-encoding and non-coding RNAs (Carninci et al., Science. 2005 Sep. 2; 309 (5740): 1559-63, Gerhard et al., Genome Res. October 2004; 14 (10B): 2121-7, Imanishi et al., PLoS Biol. June; 2 (6): e162). Obtaining full-length cDNA has been a beneficial understanding of genomic structure and function and mapping of genes on the genome. Furthermore, obtaining full-length cDNA is a means for expressing the encoded protein, which can then be transferred to other functional vectors. For example, proteins can be cloned into gateway vectors (Gateway is a trademark of Invitrogen) and used for protein expression, purification, and many other functional studies.

  In addition, analysis of the 5 'end allowed measurement of gene expression associated with promoter identification (Carninci et al., Nature Genetics in print). By capturing the 5 'end tag (Harbers and Carninci Nat Methods. July 2005; 2 (7): 495-502), the transcription initiation site and thus the promoter region that regulates gene expression Can be identified. The promoter region can be divided into a core promoter and long-range regulatory elements, but the core promoter (one that is in close proximity to the start site) can be identified very efficiently, and thus the transcription network (transcription Facilitates further functional analysis, such as communication between regulatory elements) and expressed RNA. This analysis is part of a new field called “system biology”. Following this philosophy, it is essential to understand biological systems in order to take into account all the components of this system and integrate its knowledge.

  However, until now, such techniques have required relatively large amounts of starting material (Carninci et al., Genome Res. June 2003; 13 (6B): 1273-89, Shiraki et al., Proc Natl Acad Sci USA.December 23, 2003; 100 (26): 1577-81; Kodius et al., Genome Res.June 2003; 13 (6B): 1273-89; Hashimoto et al., Nat. Biotechnol., September 2004; 22 (9): 1146-9) Other techniques to capture the 5 'end require extensive amplification (eg PCR; Suzuki and Sugano). ), Methods Mol Biol. 003; 221: 73-91), thus causing a false indication of the frequency of the cDNA, as outlined in (Carninci et al., Genome Res. June 2003; 13 (6B): 1273-89). .

  However, RNA expression is very different in the various cells that make up a given tissue. A tissue is composed of a large number of cells that express some common RNA and many very different cell-specific RNAs. Therefore, 5 'end / full length cDNA is prepared and captured from a small amount of cells so that the different cells that make up the tissue can be analyzed separately for their expressed RNA and their promoter usage. New technologies are needed to make this possible. This is essential for downstream applications including understanding of biological systems and identification of transcriptional networks and their perturbation / regulation by drugs.

  In the present invention, we describe a method that simplifies obtaining a 5 'tag starting from the beginning of a full-length cDNA molecule or 5' mRNA.

<Availability>
The applicability of the present invention is to create full-length cDNA and CAGE (cap-analyzed gene expression) libraries from a limited amount of tissue. This is because the three steps involved in RNA derivatization do not involve precipitation and therefore no nucleic acid loss occurs. In another embodiment, this protocol is also used for general cDNA preparation because the steps are simplified and allow for significant time and workload savings during preparation of the cDNA / 5 ′ end tag. be able to. The combination of all steps of the present invention, including from isolating the 5 'end of RNA to determining the sequence, is used as a kit or tool. One embodiment of the flow of the present invention is shown as FIG.

<Outline of the invention>
The present invention relates to a method for isolating fragments from nucleic acid molecules for cloning and analysis. The invention thus relates to the conversion of a sample containing one or more nucleic acid molecules, in which case such a nucleic acid molecule or mixture of nucleic acid molecules will be converted to DNA.

  In one embodiment, the present invention relates to the manipulation of nucleic acid molecules, where such nucleic acid molecules will be prepared in the form of linear single stranded DNA. Accordingly, the present invention relates to the preparation and manipulation of linear single stranded DNA.

  In certain embodiments, the invention relates to modification of an RNA molecule or RNA molecules to introduce sequence information at the 5 'end of the RNA molecule. The present invention therefore relates to the modification of RNA, in which case the information added to the RNA molecule is used for manipulation and / or analysis of the RNA molecule.

  In another embodiment, the invention relates to the conversion of unmodified RNA molecules and / or modified RNA molecules by transcribing RNA into cDNA. The present invention therefore relates to the synthesis and preparation of single-stranded DNA molecules.

  In a slightly different embodiment, the present invention relates to the use of single stranded DNA molecules to obtain sequence information directly. Therefore, the present invention relates to obtaining sequence information from a defined region of a single-stranded DNA fragment, that is, the 5 'end described above. In certain embodiments, the 5 'end specific sequence information of the DNA fragment relates to the 5' end sequence of the RNA molecule. Accordingly, the present invention relates to obtaining sequence information from RNA molecules.

  In another embodiment, the present invention relates to tag sequencing to enable annotation and statistical analysis by computer-aided means. Accordingly, the present invention relates to means for gene discovery, gene identification, gene expression profiling, and annotation.

  In a slightly different embodiment, the present invention relates to tag sequencing to allow annotation and statistical analysis by computer-aided means, where such tags are derived from regions within the genome. Let's go. The present invention therefore relates to the characterization of genetic elements in the genome.

  In a slightly different embodiment, the present invention relates to the preparation of hybridization probes from the terminal nucleic acid molecules, in which case such regions will be analyzed using in situ hybridization. In a preferred embodiment, the in situ hybridization experiment will utilize a tiled array.

  In another slightly different embodiment, the present invention relates to full length cloning of nucleic acid molecules. In another embodiment, sequence information as obtained from the tag is used in primer design, in which case such primers are used to amplify nucleic acid molecules in an amplification reaction. It is within the scope of the present invention to amplify and clone transcribed regions and genomic fragments in such a way, in which case such fragments may comprise genetic elements, the promoter regions described above.

  Thus, the present invention provides a means for analyzing nucleic acid molecules and short fragments thereof as needed, eg, for characterization of biological samples.

<Detailed Description of the Invention>
The present invention relates to RNA / nucleic acid analysis from biological samples. The term “biological sample” encompasses any kind of material obtained from organisms including microorganisms, animals and plants, and any kind of infectious particles including viruses and prions that depend on the host organism for replication. A “biological sample” as such encompasses any kind of material obtained from a patient, animal, plant or infectious particle for research, development, diagnostic or therapeutic purposes. Thus, the present invention is not limited to the use of specific nucleic acid molecules or their origin, and the present invention provides a general means to be applied and used in the study and manipulation of a given nucleic acid. Such nucleic acid molecules used to practice the present invention are disclosed in Sambrook J., 2001, issued by Cold Spring Harbor Laboratory Press, New York. And Russell D.M. W. Authors, Molecular Cloning, Lab Manual (Sambrook J. and Russuell D.W., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 2001). It can be obtained or prepared by methods well known to those skilled in the art.

  RNA is considered a single-stranded nucleic acid molecule for purposes of the present invention, even if such a molecule may form a secondary structure that includes a double-stranded RNA portion. In particular, RNA includes, for the purposes of the present invention, any form of nucleic acid molecule that consists of ribonucleotides and is unrelated to a specific sequence or origin of the RNA. Thus, RNA may be transcribed in vivo or in vitro by an artificial system, may not be transcribed, may be spliced or not spliced, and may be incompletely spliced. May be processed, independent of its natural origin, obtained synthetically, derived from artificially designed templates, mRNA, tRNA, rRNA, or any of them It may be a mixture. More precisely, the expressions “DNA”, “RNA”, “nucleic acid”, and “sequence” encompass the nucleic acid material itself, so that specific sequence information, vectors, phagemids or other specific nucleic acid molecules are included. It is not limited.

  A large section of RNA is capped RNA and uncapped RNA. Uncapped RNA is not recovered and constitutes the majority of RNA in the sample (at least 95% of the species). For this reason, for the purposes of the present invention, the starting RNA types should be grouped by the presence of a capping site.

  mRNA usually refers to RNA with a capping site and a poly A tail, constituting 1-3% of the total, and encoding a protein. Another capped molecule is nc-RNA, which does not code and is poorly polyadenylated but has a cap structure. Together, these two make up less than 5% of the RNA molecules in the cell. Thus, although we refer to “total RNA” and “capped RNA”, total RNA contains up to about 5% capped RNA. By way of example, roughly 1 molecule / 20 molecules of RNA contains capping. Thus, to process a similar number of capped molecules, a much larger amount of “total RNA” must be used (about 20 times) than the “capped RNA” fraction. This difference is important to distinguish between the use of total RNA, including a much larger proportion of available molecules, and the use of cap-selected or poly-A selected RNA.

  By solid matrix is meant throughout this document a solid having an indefinite size, including beads and surfaces, which may have any shape. Among them, there are, but are not limited to, magnetic beads, beads including coated beads, and slides made of glass, plastic, silica, Teflon or any other suitable material. Such matrices may be inert or reactive, eg, streptavidin, antibodies, reactive chemical groups, or derivatives of nucleic acids having one or more modifications or bases and / or backbone sequences. It may be coated with any form of nucleic acid (RNA, DNA, hybrid molecule). In this document, the definitions of “matrix”, “surface”, and “solid surface” refer to nucleic acids that bind to an object that is not in solution and are synonymous to allow nucleic acid isolation or capture or further manipulation. Used for.

<Current cloning protocol>
However, one major limitation of the above technique is the ability to work with small samples, reducing the applicability of the method. Although RNA was a limiting factor, the protocol requires a minimal amount of RNA, varying from 50 μg total RNA. With less than a few hundred nanograms of capped RNA, no full-length mRNA capture has been reported (requires μm total RNA).

  There are several methods that have been used to date to capture full-length cDNAs through the capping site, and a comprehensive literature review within this description is not possible. Only the main but representative methods are described here. Most methods take advantage of the presence of the cap structure of mRNA (or other non-coding RNA) present at the 5 'end. When cDNA preparation begins on the 3 'end from the poly A tail, selection of the cDNA through this portion allows the full length cDNA to be captured. If there is no full-length cDNA that protects the RNA hybridized to the cDNA, this may be facilitated by ribonuclease digestion of the RNA.

<Cap modifier by derivatization of cap part on RNA>
These methods include cap trapping (Carninci and Hayashizaki, Methods Enzymol. 1999; 303: 19-44) and the Genset patent (US Pat. No. 5,962,272, US). Including patent No. 6,022,715 These methods were very effective in efficiently capturing the 5 ′ end of mRNA / RNA (up to 95% efficiency reported, reference) These methods start with a relatively large amount of high starting RNA material, greater than 1 μg of total RNA (Carninci et al., Genome Res. June 2003; 13 (6B): 1273-89).
These methods cannot be used for less than 1 μg total RNA.

<Cap Binding Protein / Peptide (Edery et al., Mol Cell Biol. June 1995; 15 (6): 3363-71)>
Another method is based on the capture of the capping site via a cap binding protein after the first strand cDNA. In this regard, the cap binding protein is used to capture cDNA from the 5 ′ end. An alternative version would involve capturing RNA with a cap-binding antibody or with other fragments of antibodies or phage display antibodies.

  This method (Edery et al., Edery et al., Mol Cell Biol. June 1995; 15 (6): 3363-71) was used with only a few micrograms (μg) of mRNA. However, it has not become popular because it is difficult to bind cap binding proteins to solid support matrices.

<Method based on oligo capping (Suzuki and Sugano, Methods Mol Biol. 2003; 221: 73-91)>
This group of methods is based on replacing the 5 ′ end cap with a different primer sequence (oligonucleotide), which may be RNA, DNA, or a hybrid DNA / RNA molecule. Only the cDNA that reaches the complexed 5 'end is subjected to further manipulations, such as copying to second strand cDNA and PCR. This group of methods also has the disadvantage of relatively low efficiency and has gained a reputation for requiring multiple PCR cycles before obtaining sufficient material for an RNA library. In these methods, several micrograms (μg) or more of RNA has been used.

<Cap Switch Method (Zhu et al., Biotechniques. April 2001; 30 (4): 892-7.)>
The cap switch method is based on the addition of trinucleotide GGG at the 5 ′ end of RNA, particularly at the capping site. The cDNA was primed with oligo-dT to minimize contamination with ribosomal RNA that does not carry a poly A tail. This method is particularly attractive because it does not require a capping operation. Using this method, researchers were able to create cDNA probes using single cells. However, this method still had two problems. For one, the cap switch is inefficient and requires PCR. Since PCR amplification of long inserts is defeated by shorter PCR products derived from short mRNA, long cDNA clones are rarely recovered, and PCR-based full-length cDNA library construction is problematic. Another disadvantage is that three G nucleotides are added to the 5 ′ end of the cDNA. If these are used in 5 ′ end tagging technology, the class II S restriction enzyme is used to cleave the 5 ′ end tag, thereby providing 3 bases (for the description of the tagging cDNA end of 20 bases, see below. Will be lost as useful information. This is particularly important when mapping them onto the genome (see Mapping tags on the genome).

  Other methods for full-length cDNA synthesis consist of general improvements over the prior art. A simple method is to simply select cDNA based on size. Long cDNA selection based on size. Long cDNA molecules are much more likely to be non-cleavable cDNA molecules than short cDNA molecules (see, eg, Nomura et al., DNA Res. 1994; 1 (5): 223-9).

  Another example of a classical method for tracking cDNA (Okayama and Berg, Mol Cell Biol. February 1982; 2 (2): 161-70) Useful for catching. Alternatively, or in combination with any one of the above techniques, improved reverse transcriptases, such as Superscript II and Superscript III (Invitrogen), contained in the first strand of a full-length cDNA preparation (Invitrogen)) is useful for preparing a cDNA library containing many full-length cDNAs. However, the latter gives a much higher certainty that the abundantly identified 5 ′ end is a true transcription start site and may contain a much higher percentage of full-length clones (> 95%). Thus, in order to capping selected full-length cDNAs, it is important to distinguish from a library that is rich in full-length cDNAs (up to 60-70% cDNA can be full-length). Therefore, we need to mention “cap selected” or “full length selected”.

  Another important definition is the strict accuracy that identifies the 5 'end of a true full-length molecule. The true full length method identifies the transcription start site (TSS) with perfect accuracy. Although the true full length method is listed above, the first base is present in the cDNA and other sequences such as linkers or additional sequences (eg, Mol Cell Biol. February 1982; 2 (2) : GMG used in cap switches or tailing procedures used in Okayama and Berg at 161-70.

  A cap switch can be used to capture the 5 'end of a reduced amount of sample, including single cells (Gustinrich et al., Proc Natl Acad Sci USA. April 6, 2004; 101 (14 ): 5069-74.), Adding undesired sequences (the GGG), which reduces the usefulness of the approach. For example, if 5 ′ end cDNA is used for tag-based profiling, then the 5 ′ end of the cDNA is used to generate a 20 base tag for subsequent ligation and high throughput sequencing (harvesting). (As reviewed by Harbers and Carninci, Nature Methods, Nat Methods. July 2005; 2 (7): 495-502), these three bases represent the sequence of mRNA in such tags. Would replace it inconveniently. 17 bases are rarely unique in the mammalian genome, but 20 bases tend to be unique, so this will greatly hinder mapping onto the genome (tag length and mapping). Noh principle is discussed in the review of Harbers and Carnincci, Nat Methods. July 2005; 2 (7): 495-502).

  Customary cloning methods include the Gubler-Hoffman method (Gubler and Hoffman, Gene. November 1983; 25 (2-3): 263-9). . In this case, even when cDNA is synthesized up to the 5 'end of mRNA, preparation of the second strand requires RNase H cleavage, followed by second strand synthesis by DNA polymerase I and ligation of the resulting DNA fragment. The second strand polymerization mechanism requires a primer at the 5 'end with an extendable 3'-OH group. This is provided by residual RNA, but there is no suitable 3'-OH group to prime the most upstream cDNA (close to the capping site). Thus, the first 10-50 base pairs that confirm the capping site are lost when using the Gubler-Hoffman protocol, which is otherwise attractive for convenience. The cDNA is actually cloned after exonuclease treatment, where the portion of the first strand cDNA that extends to the capping site must be removed. The library obtained by this method may be quasi-full length, but not full length because it never identifies a true capping site.

This short summary of existing methods highlights the lack of a method that can efficiently produce cDNA, or the 5 ′ end cDNA desired to capture full length cDNA, for cDNA cloning or tagging techniques. All existing methods combined-Ability to capture full length cDNA from sub-nanogram (ng) RNA-Do not add unwanted homopolymer tails (eg GGG)-Capture the exact 5 'end Doing-To avoid loss, a simplified protocol in a single tube-lacking at least one of these features required for simplified protocol extensibility of operation.

<New One-tube Invention>
The term “nucleic acid” as used herein refers to at least one or more modifications introduced by a natural nucleic acid, an artificially synthesized or prepared nucleic acid, a naturally occurring event, or through techniques well known to those skilled in the art. It is also used to encompass modified nucleic acids.

  Similarly, DNA or RNA molecules can function specifically as hybridization probes, and as such, for the purposes of the present invention, or such probes are used for the detection of related nucleic acid molecules. In such experiments, such probes and target molecules are related as “complementary sequences” even if they are distinguishable by spontaneous or artificially introduced mutations at individual positions. ing.

  We represent the 5 'end of a full length mRNA molecule suitable for full length cDNA isolation, 5' end tag isolation, 5 'end enriched mRNA / cDNA isolation and other analytical applications not limited to these descriptions. We have developed a novel method called the One-Tube concept that adds one nucleic acid to a nucleic acid. The method is based on having a series of reagents added to RNA, or a mixture of RNA, in a single test tube.

  These mRNAs may be derived from cells, tissues, or any other biological source that contains RNA. In one embodiment, these RNAs are derived from human, animal or plant tissues or cell lines and are either total RNA or either size, RNA characteristics (eg: presence of poly A tail in most mRNAs) It may be composed of selected RNA fractions, cell compartments (eg, nuclear RNA, cytoplasmic RNA, polysomal RNA, membrane-bound polysomal RNA, and RNA belonging to other ribonucleoprotein complexes).

  In another embodiment, the RNA may be derived from other biological fluids such as blood or serum. For example, the RNA may include viral RNA or other potential parasites from an individual's blood. Capturing the 5 'end of such mRNA will allow for the diagnosis of potential parasites.

  In another embodiment, RNA is obtained from purified cells, including cells that have been flow-sorted from cleaved tissue. These include cells labeled with fluorescent antibodies that can be selected by flow sorting, or cells that are labeled by gene transfer expression of markers, such as green fluorescent protein (GFP), that are frequently used in mammalian experiments. Either may be sufficient.

  Alternatively, these cells can be selected based on their morphology or other labeling by laser capture microdissection.

  These are not the only methods for extracting RNA for this application, but are merely examples of the potential utility of the present invention.

  The present invention is based on adding a reagent to the 5 'end of the RNA in a single tube until the RNA is specifically labeled with "nucleic acid". The mRNA is known to have a capping site, in which case this capping site is another nucleic acid molecule, typically RNA, DNA or DNA / RNA hybrids (but RNA / peptide nucleic acid hybrids etc. , Other nucleic acids may be appropriate). Nucleic acids attached to the 5 ′ end of the RNA include various non-conventional bases and non-conventional backbone incorporations, such as α-thio derivatives of nucleic acids already used in general DNA sequencing operations. Can be modified by various methods. Such nucleic acids may also contain labeled dyes for further selection, and other linking groups such as biotin or digoxigenin. In other words.

  The nucleic acid sequence attached to the 5 'end of the mRNA is not limited in length, but for most applications it is convenient to be at least 15 nucleotides long and less than 100 bases to allow efficient priming. Although well constructed, this poses a challenge for oligonucleotide synthesis. However, these are not limitations on the results, but incidental manipulations (eg priming) and practical limitations on oligonucleotide RNA synthesis.

  Nucleic acids that bind the 5 'end of DNA will be single-stranded, but are also partly fully double-stranded nucleic acids. Partial duplexes are those under certain conditions (as described in Shibata et al., Biotechniques. June 2001; 30 (6): 1250-4). 'Useful for terminal derivatization.

  Ultimately, such a nucleic acid that binds the 5 'end of RNA may be a single type of molecule or a number of different nucleic acids.

  In one embodiment, the target RNA is placed in a single tube and subjected to three theoretically different steps that do not require sample purification: (1) masking of non-full length mRNA molecules, (2) capping site molecules. And (3) attachment of the treated RNA molecule to the priming nucleic acid.

  Enzymes, or terms used herein to indicate enzyme activity, are used herein to describe the action or activity of such components, but such components must be completely pure. Do not need. Accordingly, mixtures containing such enzymes, enzyme activities, or mixtures thereof with other ingredients, related or unrelated actions are within the scope of the invention.

<Limitations and principles of traditional protocols for oligo capping>
The above reactions (1)-(3) are usually carried out in an oligocapping protocol by exhaustive purification by alcohol precipitation followed by protease digestion and / or phenol and other organic solvent extraction at each step. Alternative and less toxic methods can be used, but all purification steps cause unacceptable sample loss. For this reason, this procedure (also known as the standard oligo capping method) is used at very low RNA concentrations because small amounts of RNA are lost during organic (phenol, chloroform) extraction and subsequent ethanol precipitation. could not.

  Such redundant and cumbersome extractions are obtained by the use of enzymes acting at different pH, buffers and conditions, and the inability to inactivate them in the next step with natural interference. For example, step (1) above required bacterial alkaline phosphatase (BAP), which acts at an alkaline pH of about pH 8. The enzyme must be inactivated before proceeding to step 2 above. If inactivated, the phosphate group will be removed from the full length mRNA obtained in step 2 (see below). However, this is not easily achieved because BAP cannot be heat inactivated with a mild heat shock at 65 ° C. Instead, the optimal activity of BAP at 65 ° C. (at pH 8 it will also cause RNA alkaline degradation). Therefore, other previous studies required organic extraction.

  In step 2, the cap is removed with tobacco acid pyrophosphatase (TAP) and then used at pH 6. TAP removes the cap structure of RNA that is native at the 5 'end (which includes mRNA, but also includes a group of novel non-coding RNAs), leaving a phosphate group instead. After steps 1 and 2, only the phosphate-containing molecules correspond to full-length RNA molecules, or at least other molecules carrying intact sequences and their 5 'ends. All other RNA molecules contain an OH group at the 5 'end that is not a substrate for reaction (3). TAP must be inactivated before steps 1 to 3 are performed (see below) to interfere with this step by degrading ATP, the substrate required for RNA ligase in step 3. Therefore, also at the end of this step, organic extraction and subsequent precipitation are required, which is time consuming and causes sample loss.

  Reaction number 3 is RNA ligase. The enzyme RNA ligase adds an RNA molecule, or RNA / DNA hybrid or DNA molecule at the 5 'end. As described, RNA ligase is used as a substrate to provide the energy necessary to catalyze the linkage between the 5 ′ end of the full-length RNA and the 3 ′ end OH group of the added nucleic acid (usually an oligonucleotide). ATP is required. This reaction is carried out at various temperatures, usually at low temperatures to minimize DNA damage, pH 7.5 or 8.

<Overcoming the above limitations of reactions (1) to (3)>
In our method, we have (a) numerous extractions with phenol / chloroform and ethanol that are not welcome because they are time consuming, cause sample loss, or are expensive without replacing other nucleic acid purification steps / Introducing the concept of how to overcome the requirements of the purification step. (B) We introduce the idea of how to overcome the requirements of numerous buffer changes, and (c) We identify conditions that inactivate the enzyme without removing it from the solution The concept of how to overcome the need to change the enzyme is introduced. This allows “one-tube” full-length RNA ligation, which is also useful because it can work with small samples, simplifies laboratory operations with samples of any size, and reduces labor costs and Reduce material costs.

  The measures we have taken to enable reactions (1) to (3) in one test tube are as follows.

1) Contrary to common laboratory procedures, we have identified a method involving the enzyme used at the beginning of this method that works well with reduced buffer and salt concentrations.
2) We have devised an idea to use a set of conditions, including a buffer and a modifier buffer. This allows a gradual increase in buffer concentration through steps (1) to (3), which is surprisingly optimal for all enzymes. In other words, we have tested and found that the remaining traces of buffer and inactivated enzyme from the upstream reaction do not inhibit the downstream reaction.
3) The idea was made to use conditions that include enzyme combinations and that allow the enzymes required in steps (1) and (2) to be inactivated during step 3.
4) As with the original oligocapping method, when using total RNA instead of the purified mRNA fraction, in order to enable the method, we have A concept was established to use conditions that function with sufficiently high efficiency. This made it possible to obtain cDNA from even a very small amount of RNA.
5) Because we are a further problem when RNA is heated at high pH in the presence of buffers often containing divalent metals, the RNA is not degraded at 65 ° C during enzyme inactivation, An idea was made to use conditions to find optimal buffer conditions and pH conditions.

  In one embodiment, the enzyme phosphatase, which is heat sensitive, is successfully used. Preferably, we used in step 1 that after step 1 an anionic phosphatase that can be inactivated at 65 ° C. in a buffer that does not damage RNA even at high temperatures useful for inactivation. However, it is not limited to this enzyme. Such a buffer resulted in a pH below 7.5 and lacked divalent ions. In particular, low salinity acidic buffers that meet these requirements would be particularly useful. A modified buffer that is compatible with subsequent reactions, including addition of pyrophosphatase activity or equivalent activity, without further purification after inactivation of the phosphatase. Preferably we have used the TAP enzyme (see Example 1). After the reaction, the present invention refers to inactivation of pyrophosphatase activity that does not degrade RNA, for example by thermal inactivation in another buffer that does not damage the RNA. Finally, and we create conditions that match the activity of the enzyme to link the exogenous nucleic acid to the 5 'end of the RNA. This can be achieved by adding another modifier buffer. The exogenous nucleic acid added may be of various types, for example, an RNA oligonucleotide. A preferred enzyme for performing the addition of exogenous nucleic acid to the 5 'end of mRNA is preferentially a nucleic acid ligase. This may be a DNA ligase but is preferentially an RNA ligase such as T4 RNA ligase or other thermostable RNA ligase. This can drive, for example, the final step of tagging RNA with oligonucleotides. In a preferred embodiment, we do not degrade RNA through the method by using a low concentration, mildly acidic buffer.

  Such modified RNA can then be used for various downstream applications. In one application, full length cDNA can be obtained by priming RNA on the 3 'end tail with an oligo dT primer. Only molecules that reach the 5 'end oligonucleotide can be primed for second strand cDNA, thus obtaining a cDNA containing both the 5' end and the 3 'end. These full length cDNAs can then be further processed and cloned according to standard procedures.

  Tagging nucleic acids can carry various sequence portions that allow further functional applications. For example, a tagging nucleic acid can include a restriction enzyme and can include a polymerase sequence or a recombinant sequence. Such sequences can also be used for further purification of RNA / nucleic acid hybrids, and derivatives thereof, using nucleic acid hybridization, protein-epitope interactions, or any other chemical interaction. The method of binding the nucleic acid or derivative is merely an example citation and is not limited to the above method.

  Alternatively, the 5 'terminal oligonucleotide may be an RNA oligonucleotide comprising a restriction site of a class-IIs restriction enzyme. These enzymes recognize sequences but cleave outside of their recognition sequences; if designed appropriately, the class IIs restriction enzyme MmeI cleaves 20/18 bases inside the cDNA and 5 ′ end tag (also known as (Reference: Hashimoto et al., Nat Biotechnol. September 2004; 22 (9): 1146-9; Kodzius et al., Nat Methods. 2006). March; 3 (3): 211-22). In this embodiment, the 5 'end tag is isolated and bound to form a concatamer for high-throughput sequencing; concatamers allow much more cost-effective sequencing utilization. These concatamers may be sequenced directly after ligation using a linker suitable for the 454 Life Science sequencer process based on pyrosequencing, or by Sanger method or any suitable sequencer It may be cloned into a plasmid cloning vector suitable for conventional sequencing, such as the pZero plasmid available from Invitrogen. A “tag” according to the present invention may be any region of a nucleic acid molecule, as prepared by the method of the present invention, where the term “tag” as used herein is the nucleic acid from which it is naturally occurring. Derived from a modified nucleic acid into which at least one or more modifications have been introduced, either by an artificially synthesized or prepared nucleic acid, by a naturally occurring event or through techniques well known to those skilled in the art, Includes nucleic acid fragments. Furthermore, the term “tag” relates to the nucleic acid molecule itself, rather than certain specific sequence information or their composition.

  In one embodiment, the first strand primer may not only be an oligo dT primer, but may also be a primer comprising a random sequence at the 3 'position, for example 6 or 9 random bases. The nucleic acid primer may also comprise a sequence-specific oligonucleotide at its 5 'end, which in turn can be used for specific priming.

  In another embodiment, such a modified RNA may be used to determine the true 5 'end sequence in a protocol known as RACE (rapid amplification of cDNA ends). It has the obvious advantage of being much faster than the normal race procedure.

  In alternative embodiments, such modified RNA molecules can be bound to a solid support immediately or after their modification, eg, after transcription to first strand full length cDNA, and immobilized to such a solid matrix. Once done, further manipulations can be used, for example, to understand the primary sequence of such RNA molecules.

  In another embodiment, the 5 'end is linked to a nucleic acid carrying a promoter for a polymerase, such as RNA polymerase. This allows hybrid molecules, or derivatives thereof, to drive RNA transcription and thus replicate their own molecules or parts thereof. This molecule may comprise part of the RNA molecule or a complete RNA molecule, and may also comprise additional nucleic acid sequences.

  This method is then used to allow the technician to isolate the 5 ′ end of the mRNA in a reproducible manner for cDNA production or 5 ′ end expression profiling, among other components Kits containing reagents (chemicals) and combinations of appropriate pH, nucleic acids and enzymes.

  In another embodiment, the present invention encompasses methods for handling single stranded as well as double stranded DNA molecules. Double-stranded DNA is composed of two polymers each formed by deoxyribonucleotides, which are substantially complementary to each other allowing them to associate to form a dimer molecule. It means a nucleic acid molecule having a sequence. The two polymers are linked to each other by specific hydrogen bonds formed between matching base pairs in deoxyribonucleotides. A DNA molecule that is composed only of one polymer strand formed by two or more deoxyribonucleotides that does not have a compatible complementary DNA molecule to associate, even if such a molecule is a double-stranded DNA Even the possibility of forming a secondary structure including a moiety is considered a single-stranded DNA molecule for purposes of the present invention. As used herein interchangeably, the terms “nucleic acid molecule” and “polynucleotide” include single-stranded or double-stranded, coding or non-coding, complementary or non-complementary, and sense or antisense. Regardless, it includes RNA or DNA and also includes hybrid sequences thereof. In particular, the terms “nucleic acid molecule” and “polynucleotide” are transcribed or untranscribed, spliced or unspliced, incompletely spliced or processed, from a body material that is independent of its origin. Includes genomic DNA and complementary DNA that is cloned or obtained using synthesis.

  In different embodiments, the present invention relates to a method for isolating fragments from nucleic acid molecules for analysis. Thus, the present invention relates to the conversion of a sample containing one or more nucleic acid molecules, in which case such a nucleic acid molecule or mixture of nucleic acid molecules will be converted to DNA. For practicing the invention, the nucleic acid molecule may be derived from natural genomic DNA, RNA samples, existing DNA libraries of artificial origin, or a mixture thereof. Although the present invention is not limited to the use of individual nucleic acid molecules or multiple nucleic acid molecules, the present invention may be derived from an exciting library, regardless of whether such pluralities occur naturally, Alternatively, it can be performed with an individual nucleic acid molecule or a plurality of nucleic acid molecules that are artificially made. Furthermore, the present invention can process any nucleic acid molecule regardless of its origin or nature. Accordingly, it is within the scope of the present invention that when compared to a natural nucleic acid molecule, the nucleic acid molecule can be a full-length molecule, or a fragment thereof. Furthermore, it includes exons and introns in the transcription region, either by random processing, or by targeted analysis of nucleic acid molecules using enzymatic activity in preference to certain sequences, It can be foreseen that such nucleic acid molecule fragments could be prepared by means that would allow fragmentation based on the structure of the nucleic acid molecule without limitation. Thus, the present invention is not limited to the use of certain specific starting materials. The present invention does not rely on the use of DNA alone, and those skilled in the art can refer to Sambrook J. et al. And Russell D.M. W. Will know different techniques for converting RNA to DNA, including but not limited to the techniques disclosed in the foregoing, which are hereby incorporated by reference. After converting RNA to DNA, single-stranded or double-stranded DNA molecules having the same or complementary sequence as the original RNA, the above-mentioned cDNA can be obtained. Such cDNA molecules are generally prepared in the form of linear DNA, in which case the two open ends allow their manipulation. However, even if the cDNA is cloned into a vector, those skilled in the art know the means necessary to release the insert from such a vector and convert it to linear DNA.

  In another embodiment, the introduction of a priming site at the 5 'end of the RNA described above is used to subsequently bind the resulting nucleic acid. By using part of the sequence to bind RNA to the surface and another part to prepare for sequencing, such oligonucleotides can be used for manipulation and analysis. Used to specifically capture molecules. Alternatively, the oligonucleotide can be directly sequenced after sequencing primers of a known sequence for ligation of RNA or the resulting cDNA to the surface and for resolution. Can be used as a tag for use. Such captured nucleic acids can be used for further manipulation and analysis, including but not limited to sequencing, replication, amplification and chemical and enzymatic modifications.

  Alternatively, the nucleic acid consisting of the first strand cDNA from the composite 5 ′ RNA / RNA can be bound to a solid matrix, either directly or via hybrid nucleotides, for further solid phase manipulation, eg single molecule sequencing. Can do.

In another preferred embodiment, the resulting nucleic acid hybrid is captured with another immobilized primer capable of priming direct polymerization and sequencing reactions at the single molecule level. This allows unprecedented sequencing throughput to be applied on a single cell.
The binding of the sequence to the nucleic acid corresponding to the 5 ′ end of the mRNA does not necessarily depend on nucleic acid ligase, and other methods of capturing full-length cDNA, such as the biotinylated cap trapper group technique (Carnincci ) And Hayashizaki, Methods Enzymol. 1999; 303: 19-44) or other equivalent methods is important.

  In another embodiment, the RNA can self-ligate in the absence of oligonucleotides, but the ribosomal RNA (excess) primarily links the 5 'end of the mRNA after dephosphorylation and decapping. The RNA sequence portion of the ribosome is used for priming of second strand cDNA and further purification of derived nucleic acids, including but not limited to polymerization priming, physical immobilization or binding of other nucleic acids for isolation can do. These could then be used as substrates for massively parallel sequencers such as the 454 Life Science sequencer.

  In further embodiments, nucleic acids derived from binding of nucleic acids to the 5 'end of RNA molecules will be used directly in the sequencing reaction. This is not a limitation on the method claimed in this patent, but would be obtained with any available full length trapping method. In a preferred embodiment, the nucleic acid is suitable for single molecule emulsion PCR amplification as described in (Margulies et al., Nature. September 15, 2005; 437 (7057): 376-80.) 2 Contains two different sequences.

  In a further embodiment, in the case of biotin, the nucleic acid carrying information including the entire 5 ′ end of the nucleic acid for further binding to the matrix, which may be streptavidin or avidin, is biotin, or other reactive Label with a chemical group. This is not a limitation, as other reactive chemical groups can be used for coupling. Such complemented nucleic acids are then used for further manipulation and analysis, including but not limited to sequencing, replication, amplification and chemical and enzymatic modifications.

<Creating a library of 5'-derived RNA molecules>
This example is an exemplary protocol for derivatization of the 5 prime end of RNA molecules using RNA oligonucleotides. All reactions are performed in siliconized 500 μl microtubes using a siliconized chip each time to avoid nucleic acid loss.

The RNA sample is first dephosphorylated. RNA (eg 1 ng to 1 μg) is placed in a tube with 2 μg glycogen in a total volume of 5 μl. The reaction buffer is 1/10 of the normal concentration, ie 5 mM Bis-Tris-propane-HCl, 0.1 mM MgCl ₂ , 0.01 mM ZnCl ₂ , pH 6.0 at 25 ° C. Glycogen helps to avoid RNA sticking to the plastic during operation. Samples were denatured at 65 ° C. for 5 minutes to expose phosphate groups that are subsequently removed and kept at 37 ° C. for 2 minutes before an antactic phosphatase (New England Biolabs) Add (2.5 units). Samples are treated at 37 ° C. for 3 hours to overnight. Overnight dephosphorylation allows removal of 98-99% of the phosphate groups. Short incubations can also be performed at 45 ° C. in the presence of a final concentration of 0.6 M trehalose, which enhances activity at 45 ° C.

  The antactic phosphatase is then inactivated at 65 ° C., but before this is done, the divalent ions must be chelated. For this, 0.55 μl of a solution of (0.5 M sodium acetate (pH 6.0), 10 mM EDTA, 1% β-mercaptoethanol, and 0.1% Triton X-100) is added. This enzyme chelates divalent ions and creates a suitable environment for subsequent TAP treatment. The antactic phosphatase is also inhibited by the buffer EDTA. Final inactivation is performed at 65 ° C. for 5-15 minutes.

  This is followed by uncapping, but a simple addition of 0.2 μl (2 units) of tobacco acid pyrophosphatase (TAP). It is also possible to increase the amount of TAP up to 20 units / experiment. The reaction is carried out for 2 hours, followed by heat inactivation in this buffer at 65 ° C. for 15 minutes, after which the sample is moved onto ice. Optionally, betaine (1M) may also be added, which helps melt secondary structure in the RNA rich in GC, but is optional. After this treatment, TAP no longer degrades ATP. ATP is required for the next step. Ligation is then performed by adding a “capping RNA” oligonucleotide of any sequence, eg, [... add], at a concentration of 5 μM oligonucleotide. Add Tp 6.75 μl reaction, 2 μl RNA ligase (500 mM HEPES-NaOH (pH 8.0 at 25 ° C.), 100 mM MgCl 2, 100 mM DTT). DTT inhibits TAP. Optionally, hexaaminocobalt chloride (HCC) may also be added at a concentration of 1 mM, but this is optional and not necessary. Polyethylene glycol (PEG 8000) is then added at a final concentration of 25%, ATP at a concentration of 125 μM and finally 10 units of T4 RNA ligase. Under such conditions, the resulting mixture of previous buffers is not inhibitory to the ligation step.

  The samples are then ligated at 20 ° C. for 2 hours to overnight (16 hours). The RNA is then capped with an oligonucleotide, which can be used for different tests as described in other examples, such as full-length cDNA preparation.

The activity and buffer of each enzyme in the various steps is shown in FIG.
(A): Evaluation of the activity of an antactic phosphatase (New England Biolabs). The 5 ′ phosphorylated oligoribonucleotides were dephosphorylated for 120 minutes at 37 ° C. in the following buffer (1): Antactic phosphatase (AP) 1 ×. (2): AP 0.5 × (3): AP 0.1 × (4): H 2 O (5): Tobacco acid pyrophosphatase (TAP) 0.1 × (6): TAP 0.5 × (7) : TAP 1 × (8): TAP 0.5 × + AP 0.5 ×. The oligoribonucleotides were then radiolabeled with T4 kinase and γ-32P-ATP and analyzed by PAGE. Without prior dephosphorylation, radiolabeling is not possible due to 5 'phosphate. Positive control (9): 5'OH oligoribonucleotide. Negative control (10): 5 'phosphorylated oligoribonucleotide. AP buffer: provided by New England Biolabs. TAP buffer: provided by Epicenter.

(B) Assessment of the activity of tobacco acid pyrophosphatase (TAP) (Epicentre). γ-32P-ATP was incubated with 2U TAP (except for control lanes 2, 5, and 7) in the following buffer (1): H ₂ 0 (2), (3) and (4): TAP 1 × (5), (6) and (7): T4 RNA ligase 1 × (Fermentas) + TAP 0.25 × + AP 0.25 ×. Negative control: (2) and (5), no enzyme. Thermal inactivation control (7): TAP was heated for 15 minutes and then incubated with radioactive ATP. The ATP was degraded by TAP in lanes 3 and 4 (repeated), but not in other buffers or after heat inactivation.

(C) Evaluation of the activity of T4 RNA ligase (RNL, Fermentas) in the presence of trace amounts of AP and TAP buffer. Radiolabeled oligoribonucleotides were incubated in the presence of unlabeled oligoribonucleotides. Ligation resulted in a shift in electrical mobility in the polyacrylamide gel. The reaction was performed in the presence and absence of AP, TAP and RNL. (1): AP, TAP, RNL (2): TAP, RNL (3): AP, RNL (4): AP, TAP (5): RNL (6): TAP (7): AP (8): Enzyme None. Ligation takes place in the mixing buffer and is not impaired by the rest of the TAP.

<Production of full-length cDNA from mRNA capped with the one tube in Example 1>
Samples as described above can be desalted using a Microcon YM-100 filter as described by the manufacturer (Millipore). To the ligated RNA is added water and a reverse transcriptase (RT) primer obtainable by Invitrogen. Use 800 ng of primer AGA GAG AGA CCU CGA GCC UAG GUC CGA C (SEQ ID NO: 1) to 20 μl of reaction, and add 3 μl of sorbitol-trehalose mixture (3.3 M stock solution, final concentration 0 when final RT reaction is performed) .5M sorbitol and 4% trehalose The RNA-primer mixture is heated for 10 minutes at 65 ° C. and then stored on ice when preparing the remaining reagents, then 2 × GC buffer (Carninci, Shiraki ) Et al., Biotechniques) 11 μl, then 1 μl of 10 mM dNTP stock solution, and finally MMLV reverse transcriptase (Rnase Hminus, 1 μl of Fermentas) The GC buffer system can be replaced with a buffer recommended by the manufacturer: this reaction is mixed with the RNA sample, 2 minutes at 25 ° C. (to anneal the sample), 30 minutes at 42 ° C. Incubate for 10 minutes at 52 ° C., 10 minutes at 56 ° C., and then stop the reaction, This method frequently yields cDNA spanning the 5 ′ end of the original mRNA, which is further purified / processed For example, it can be treated with proteinase K (20 μg added together with a final concentration of 10 mM EDTA, followed by RNA and proteinase inactivation for 15 minutes at 95 ° C.) This sample is then treated with Cl4B (Amersham) (Amersham) -Pharmacia) for fractionating size and plying It is possible to or removal of the over.

The cDNA is then amplified by PCR. Takara EX-tag buffer was added to the cDNA at a final concentration of 1 ×, followed by dNTP (final concentration: 200 μM each), 5 ′ oligonucleotide (sequence: acc tcg agc cta ggt ccg ac; SEQ ID NO: 2) and 3 ′ terminal oligonucleotide (sequence: ca gcg tcc tca agc ggc cgc; SEQ ID NO: 3) (each oligonucleotide, concentration 400 nM), 2.5 mM MgCl ₂ , and a final concentration of 50 mM KCl. The components were mixed on a hot start and then at 94 ° C. after 5 minutes, and the samples were incubated for 30 cycles at 94 ° C. for 30 seconds, 58 ° C. for 30 seconds, and 68 ° C. for 1.5 minutes. This results in a 5'-end cDNA that is complete and blunt-ended according to standard techniques and can be cloned into a plasmid vector (for general information on molecular cloning and sequencing, see Sambrook et al., reference).

An example of the complete 5 'terminal sequence of a cDNA clone isolated by this method is shown here (SEQ ID NO: 4):
> 1 tgtaaaacnacggCCaGtGaATgtaaaACGACGgcCAgtGAATtgTAATACGACTCACTATAgggCgaaTtGggccgctAccggccgccatggccgcgggTattacctcgagcctaggtcgacacctcgagcctaggtccgacatcgcttctcggccttttggctaagatcaagtgtagtatctgttcttatcagtttaatatctgatacgtcctctatccgaggacaatatattaaatggatttttggaagtaggagttggaataggagcttgctccgtccactccacgcatcgaacctggcgGccgcttgaggacgctgtgcgaggtgg gtgttgagtagcgtgtcgtgaatcactagtgcgGccgcctgcaggtcgaccatatggGagagctcccaacgcgttggaTgCaTagCTtgagtattcTAtagtgtcacctaaatagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgcta

  This consists of the vector sequence (1-104), the replicated 5 ′ primer and U2 snRNA (capped, forming bases 145-297), followed by the 3 ′ primer (ACTCAACACACCACCCTCGCACAGC; SEQ ID NO: 5), and the vector sequence including.

<Application to RACE experiment>
Capped RNA can be prepared as in Example 1 with the only difference that RNA oligonucleotides have different sequences as described below. By using PCR following the method of Example 1, 5 ′ end RACE amplification (rapid amplification of 5 ′ end) is possible. The experiment was performed as follows. 500 ng of total RNA from the liver was subjected to one tube oligo capping followed by removal of unreacted oligoribonucleotides and reverse transcription with random primers. The 5 'end was amplified with a gene specific primer (TTGGAGAGAGGGTTTCGACGAGTCA; SEQ ID NO: 6) and a primer complementary to the oligo-cap (CGACTGGAGCACGAGGACACTGA; SEQ ID NO: 7).

  The experiment is shown in FIG. (1): Phenol-chloroform purification after capping one-tube (ONE-Tube). (2): Microcon YM-100 (Millipore) purification after one-tube (ONE-Tube) capping. (3) Phenol-chloroform purification after one-tube (ONE-tube) capping, no TAP during one-tube (ONE-tube) capping. (4) Negative control of PCR reaction.

<Application to 454 or other matrix>
CDNA is prepared in the same manner as in Examples 1 and 2. However, the oligonucleotide prepared for Example 4 is carefully designed to have different adapters at the 3 ′ and 5 ′ ends of the RNA: (Adapter A: CCATCTCATCCCTCGCGTCCCCATCTGTTCCCCCCCCTTCTCAG (SEQ ID NO: 8); Adapter B : / 5BioTEG / CCUAUCCCCUGUGUGCCUUGCCUAUCCCCUGUUGCGUGUUCAG (SEQ ID NO: 9)). Adapter B is used as the “oligo capping” sequence and A is used to bind to the oligo-random primer for first strand synthesis. After first strand synthesis, the material is passed through a Cl-4B spin column to separate excess unreacted primer. The sample is then emulsion-PCR followed by a description of the 454-Life Science sequencer (Margueries et al., Nature. 15 September 2005; 437 (7057): 376-80). Follow the sequencing reaction as described. This makes it possible to acquire hundreds of thousands of arrays in one execution.

<Application to 5 'terminal sequencing tag>
CDNAs were obtained as in Examples 1 and 2, and those of ordinary skill in the art as described in (Kodius et al., Nat Methods. March 2006; 3 (3): 211-22). Samples are processed until second strand cDNA is obtained using a well-defined standard protocol. The cDNA is then cleaved with MmeI followed by the addition of a second linker, amplification, purification and concatamer generation. Detailed protocols for such procedures are described elsewhere (eg, Kodzius et al., Nat Methods. March 2006; 3 (3): 211-22). Such sequencing tags are then further sequenced and identified by gene boundaries (Carninci et al., Science. 2 Sep. 2005; 309 (5740): 1559-63), expression profiling and promoters of the gene ( Harbers and Carnincci, Nat Methods. July 2 (7): 495-502).

<Sequencing DNA bound to solid surface>
The cDNA was obtained as in Examples 1 and 2, and would be apparent to one skilled in the art as described in (Kodius et al., Nat Methods. March 2006; 3 (3): 211-22). Using standard protocols, the sample is processed until first strand cDNA is obtained. The nucleic acid is then attached to a solid phase matrix as described in US patent applications US 2006012793, US 260012784, US 20060008824, and devices based on such techniques.

Cited material:

2 shows an example of a flow embodiment of the present invention. The activity and buffer of each enzyme in various steps is shown. The result of Example 3 is shown.

Claims (13)

A method for capturing nucleic acid ends suitable for a limited amount of starting material based on sequential addition of reagents in a compatible buffer comprising:
(A) removing the 5 ′ phosphate group of the non-full length RNA molecule;
(B) removing the capping site from the 5 ′ complete RNA molecule;
(C) adding an appropriate nucleic acid at the 5 ′ end of such a molecule derived in step (b),
A method characterized in that all of the steps are completed in one test tube by sequentially adding reagents.   The method of claim 1, wherein the resulting modified RNA is subjected to reverse transcription to obtain cDNA.   The method according to claim 2, wherein the obtained cDNA is used to prepare a full-length cDNA library.   The method of claim 2, wherein the obtained cDNA is used to isolate a sequence tag corresponding to the end of the RNA.   The method according to claim 4, wherein the obtained sequence tag is used for the preparation of nucleic acid concatamers.   6. The method of claims 4 and 5, wherein the fragment is isolated at the 5 'end of the RNA.   6. The method of claims 4 and 5, wherein both the 5 'and 3' end tags are used to create a 5'-3 'end ditag.   The method according to claim 1, wherein the obtained DNA is used for high-throughput sequencing.   The method according to claim 1, wherein the cDNA is used for detection of the 5 ′ end.   9. The method of claims 1-8, wherein the derivatized nucleic acid or its complementary nucleic acid, or derivatives thereof with or without substitutions are bound to a matrix for further analysis.   11. The method of claim 10, wherein the resulting nucleic acid bound to the matrix is applied to a suitable sequencer to determine its sequence.   The method according to claim 10, wherein the obtained nucleic acid corresponds to a 5 'terminal RNA molecule obtained by a 5' terminal molecule enrichment method.   A kit comprising a combination of all steps according to claims 1-12.