WO2013036282A2 - Downregulation of inflammatory micrornas by ilt3 - Google Patents

Abstract

It has been discovered that inhibition of two or more specific inflammatory miRs (30b, 21, 146a, and 155) suppresses T cell proliferation, promotes T cell anergy or induces the formation of suppressor T cells, thereby providing a focused therapy with minimal toxicity for disorders associated with abnormally high immune responses. The corollary involves increasing the level of certain proinflammatory miRs thereby providing methods for immuno stimulation. It has also been discovered that significant increases of serum miR21 which occur in heart allograft rejection can be used to identify patients that have this disorder without requiring a biopsy.

Description

DOWNREGULATION OF INFLAMMATORY MICRORNAS BY ILT3

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of Provisional Application No. 61/532,031, filed September 07, 2011, the entire contents of which are hereby incorporated by reference as if fully set forth herein, under 35 U.S.C. § 119(e).

BACKGROUND

[0002] Progress in understanding T cell activation, inactivation and modulation is being translated into strategies able to induce selective immunosuppression to treat different pathological situations, notably autoimmune diseases, allergies, and allograft rejection. The development of biologic agents which can modulate directly the effector function of T lymphocytes avoiding the iatrogenic toxicity is the goal of numerous studies. Several high profile drugs and biologies failed the rigors of clinical trials or had disappointing preclinical results (FTY720, FK778, anti-CD154, anti-IL15, anti-CD28, R3421). Certain recombinant proteins with inhibitory function such as CTLA4Ig (Belatacept) and various cytokines that seem to elicit the differentiation of CD4+ regulatory T cells have been also introduced in clinical trials particularly for treatment of autoimmune conditions. Novel immunosuppressive regimens based on T cell adhesion or costimulation blockade using Belatacept or the anti-LFAl humanized mAb (Efalizumab) may be an effective alternative to improved graft function and longevity while minimizing renal and beta cell toxicity associated with the use of calcineurin inhibitors.

[0003] The medical need for selective immunosuppression is very high, as the available immunosuppressive drugs are substantially inadequate because of limited efficacy, modest selectivity, and considerable toxicity. SUMMARY OF THE INVENTION

[0004] A first set of embodiments of the invention is directed to methods for treating a subject with a disorder associated with an abnormally high immune response (such as transplant rejection, an autoimmune disease, graft vs. host disease, and inflammation), by: a) identifying a subject that has a disorder associated with an abnormally high immune response, b)

administering to the subject a therapeutically effective amount of immunosuppressive agents that reduce the expression or biological activity of at least two miRs selected from the group consisting of miR 30b, miR 155, miR-146a and miR 21, wherein the agents are selected from the group comprising (i) antisense DNA or RNA or chimeras thereof, small interfering RNA

(siRNA), micro RNA (miRNA), short hairpin RNA, ribozymes, antagomiRs, antimiRs, supermiR, and aptamers, and (ii) oligonucleotides comprising the binding site in BCL6 mRNA for miR 30b, the binding site in SOCS 1 mRNA for miR 155, the binding site in CXCR4 mRNA for miR-146a and the binding site in DUSP10 mRNA for miR 21, or biologically active fragments of the respective binding sites, wherein the therapeutically effective amount is an amount that reduces the abnormally high immune response thereby treating the disorder.

[0005] Another set of embodiments is directed to methods for treating a subject afflicted with a disorder associated with an abnormally high immune response using ex vivo methods, by a) identifying such a subject, b) obtaining T cells from the subject, c) maintaining the T cells under conditions that induce the T cells to differentiate into T suppressor cells, d) contacting the T cells ex vivo with immunosuppressive agents described above, that reduce the expression or biological activity of at least two miRs selected from the group consisting of miR 30b, miR 155, miR- 146a and miR 21, wherein the immunosuppressive agents are provided in an amount that induces the T cells to differentiate into T suppressor cells, e) determining that the T cells have differentiated into T suppressor cells, and f) intravenously administering the T suppressor cells to the subject in a therapeutically effective amount that reduces the abnormally high immune response, thereby treating the disorder. In these methods the T cell is a CD4+ T cell, a CDS+ T cell, or a CD8+ T cell.

[0006] The above methods for treating abnormally high immune responses can further include administering one or more proteins selected from the group consisting of BCL6, SOCS 1, CXCR4, and DUSP10, preferably 2 or more. Alternatively some embodiments include treating the high immune response with combinations of two or more of the above peptides in therapeutically effective amounts.

[0007] Other embodiments include methods for treating a subject that has a disorder associated with an abnormally low immune response, by a) identifying the subject, b) administering to the subject a therapeutically effective amount of at least two miRs selected from the group consisting of miR 30b, miR 155, miR-146a and miR 21, or at least two

oligonucleotides selected from group consisting of miR-specific, chemically- stabilized, double- stranded RNA oligomers, that mimic the function of a particular endogenous mature miRs selected from the group consisting of miR-30b, miR-146a, miR-155 and miR-21, or inhibitory oligonucleotides that reduce the expression of at least two proteins selected from the group consisting of BCL6, SOCS 1, CXCR4, and DUSP10, or combinations thereof , wherein the therapeutically effective amount is an amount that increases the abnormally low immune response thereby treating the disorder.

[0008] Other embodiments are directed to various pharmaceutical formulations including formulations comprising therapeutically effective amounts of immunosuppressive

oligonucleotides that reduce the expression or biological activity of at least two miRs selected from the group consisting of miR 30b, miR 155, miR-146a and miR 21, or two or more immunosuppressive peptides, or combinations thereof.

[0009] Other pharmaceutical formulations include formulations comprising therapeutically effective amounts of two or more immuno stimulatory oligonucleotides selected from group consisting of miR-30b, miR-146a, miR-155 and miR-21, and miR-specific, chemically- stabilized, double-stranded RNA oligomers, that mimic the function of endogenous mature miRs selected from the group consisting of miR-30b, miR-146a, miR-155 and miR-21, and inhibitory oligonucleotides that reduce the expression of a protein selected from the group consisting of BCL6, SOCS 1, CXCR4, and DUSP10, or combinations thereof.

[0010] Another set of embodiments is directed to methods for determining if a subject having received a heart allograft is undergoing a rejection, comprising a) obtaining a pre-allograft serum sample from a subject and determining a pre-allograft level of miR21 in the sample, b) obtaining a post-allograft serum sample from the subject, and determining a post-allograft level of miR21 in the sample, c) comparing the miR21 level in the pre-allograft and post-allograft samples, and d) if the miR21 level in the post-allograft sample is more than about 20% higher than the miR21 level in the pre-allograft level, then determining that the subject has a grade 2R/3A rejection. The method can further include treating the subject for 2R/3A rejection, and/or performing a biopsy to confirm the diagnosis of 2R/3A rejection.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Identification of micro RNA differentially expressed by CD8+ T cells primed in the presence or absence of ILT3.

[0011] (A) Micro RNA array in unprimed CD8+ T cells, and CD8+ T cells alio stimulated in the presence or absence of ILT3Fc. Arrows indicate miR upregulated in alloactivated CD8+ T cells and suppressed by ILT3Fc. (B) RT PCR analysis of miRs identified above. (C) Expression of inflammatory miRs in CD8+ T cells stimulated in MLC with control or ILT3 -knockdown (ILT3KD) DC.

Figure 2. Activation of BCL-6, SOCS-1 and DUSP10 genes by ILT3Fc is 3'UTR dependent.

[0012] (A) Real-time PCR analysis of selected genes expressed by CD8⁺ T cells allostimulated in the presence or absence of ILT3Fc. (B) Effect of ILT3Fc on BCL6, SOCS l and DUSP10 3'UTR reporter assays. The 3' UTRs of these genes were transfected into CD8+ T cells stimulated with CD3-CD28 antibodies for 2 days in the presence or absence of ILT3Fc. Internal firefly luciferase activities were used for normalization. Statistical significance is indicated by *, p<0.05.

Figure 3. Direct targeting of ILT3Fc inducible genes BCL6 , SOCSl and DUSP10 by miR- 21, miR-30b and miR-155.

[0013] (A) Predicted miR targets in the 3'UTRs of DUSP10, SOCS l and BCL6. (B) Western Blot analyses of polyclonally stimulated CD8⁺ T cells transfected with control, non-targeting RNA oligomers (ctl) or BCL6 or SOCS l gene- specific mimic miR oligomers. Expression of beta-actin was used as a loading control. NSB: non-specific band. (C) RT PCR analysis of DUSPIO, BCL6, and SOCS l expression in polyclonally activated T cells transfected with miR hairpin inhibitors of miR-21, miR-30b, or miR-155 or non-targeted control (ctl). (D) Analysis of site-directed mutagenesis of miR-21, -30b and -155 targets located in 3'UTR regions of DUSPIO, BCL6 and SOCS l. Consensus nucleotides are indicated in upper case, mutated nucleotides are shown as lower case. Normalized reporter activity shows that mutations in the 3' UTR of targeted mRNA abrogate the inhibitory activity of miR-21, -30b, and -155.

Figure 4. Effect of CD8 T cells transfected with miR inhibitors on T cell proliferation.

[0014] Polyclonally activated CD8 T cells were transfected with individual miRs or combinations of two and then added to resting autologous CD4 T cells and APC. Anti CD3 mAb were added to trigger proliferation. CD3 T cells stimulated in the presence or absence of ILT3Fc were used as controls.

Figure 5. ILT3Fc inhibits miR promoter activities

[0015] (A) MiR gene promoters were co-transfected with Firefly luciferase reporter plasmids containing miR-21, -146a or -155 gene promoters and a control Renilla luciferase reporter construct into Jurkat cells. After 48 h of incubation with CD3/CD28 mAbs, normalized luciferase activity was measured. Mutation sites are indicated by X. Sites which are distal or proximal to the RNA start are indicated by "D" and "P" respectively. (B) ILT3Fc inhibits miR- 21, -146a and -155 promoter reporter activity. The promoter activity was tested in CD3/CD28 triggered Jurkat cells which had been pre-treated with ILT3Fc or control human IgG.

Figure 6 . Effect of ILT3Fc on BCL6 and SOCSl promoters

[0016] ILT3Fc treated CD8 T cells from cultures stimulated with CD3 and CD28 mAbs were transfected with BCL6 and SOCS l promoter constructs. DETAILED DESCRIPTION

[0017] It has now been discovered that inhibition of two or more specific inflammatory miRs (30b, 21, 146a, and 155) suppresses T cell proliferation, promotes T cell anergy or induces the formation of suppressor T cells, thereby providing a focused therapy with minimal toxicity for disorders associated with abnormally high immune responses. The corollary involves increasing the level of certain proinflammatory miRs thereby providing methods for immunostimulation. These results have strong therapeutic implications for treating diseases or disorders associated with abnormal immune responses, either responses that are too strong or too weak. It has also been discovered that significant increases of serum miR21 occur in heart allograft rejection, this can be used to identify patients that have this disorder without requiring a biopsy.

Definitions

[0018] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et ah, Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002); Harlow and Lane Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990); Principles of Neural Science, 4.sup.th ed., Eric R. Kandel, James H. Schwart, Thomas M. Jessell editors. McGraw-Hill/Appleton & Lange: New York, N.Y. (2000).

[0019] "Inflammation" is a stereotyped response considered to be a mechanism of innate immunity, as compared to adaptive immunity, which is specific for each pathogen. Inflammation can be classified as either acute or chronic. It is a local response to cellular injury that is marked by capillary dilatation, leukocyte infiltration, redness, heat, and pain and that serves as a mechanism initiating the elimination of noxious agents and of damaged tissue. Leukocyte extra asate from the blood into inflammatory sites through complementary ligand interactions between leukocytes and endothelial cells. Activation of T cells increases their binding to hyaluronate (HA) and enables CD4 -mediated primary adhesion (rolling). Science 24 October 1997: Vol, 278 no. 5338 pp. 672- 675. Chronically activated T cells are found in inflamed joints, and T-cells from patients with chronic heart failure (CHF ) had enhanced surface expression of the activation markers CD69 and CD25, signs of T-cell activation. Cardiovascular Research 60 (2003) 141-146 Yndestad, et al.

[0020] "Immunosuppressive agents" for use in embodiments of the present invention include (i) "immunosuppressive oligonucleotides" that include isolated inhibitory oligonucleotides such small interfering RNA (siRNA), micro RNA (miRNA), antisense oligonucleotides, ribozymes, antisense, antagomir, antimir, supermir, and aptamer, that reduce expression or biological activity of a target miR (miR30b, 155, 146a and 21), and oligonucleotides each of which comprises at least one of the miR target sites in the 3' UTRs of the mRNA encoding the respective proteins: BCL6 for the miR 30b, in SOCS l for miR 155, in CXCR4 for miR- 146a and in DUSPIO for miR 21, and "immunosuppressive proteins" include BCL6, SOCS l, CXCR4, and DUSPIO that are targeted by the miRs. These agents can be administered therapeutically or prophylactically as immunosuppressants.

[0021] "Immunostimulatory agents" means (i) two or more, preferably all, of the miRs selected from the group consisting of miR-30b, miR-146a, miR-155 and miR-21; (ii) two or more gene- specific, chemically- stabilized, double- stranded RNA oligomers, that mimic the function of endogenous mature miRs (miR mimics) selected from the group consisting of miR-30b, miR- 146a, miR-155 and miR-21, or (iii) agent(s) such as inhibitory oligonucleotides that reduce the expression of the two or more proteins selected from the group consisting of BCL6, SOCS l, CXCR4, and DUSPIO proteins.

[0022] As used herein, a "therapeutically effective amount" is an amount sufficient to inhibit the progression of an enumerated disease in a subject.

[0023] "Immunostimulatory agents" include miRs 30b, 146a, 155 and 21; gene specific-, chemically stabilized-, double stranded- RNA oligomers, that mimic the function of endogenous mature miR (miR mimic); and inhibitory oligonucleotides comprising antisense, siRNA or hairpin RNA that reduce expression or biological activity of the proteins targeted by the respective miRs: BCL6, CXCR4, SOCS l and DUSP10.

[0024] "Anergy" means a lack of reaction by the body's defense mechanisms to foreign substances, and consists of a direct induction of peripheral lymphocyte tolerance. An individual in a state of anergy often indicates that the immune system is unable to mount a normal immune response against a specific antigen, usually a self-antigen. T cells are said to be anergic when they fail to respond to their specific antigen. Anergy is one of three processes that induce tolerance induction, modifying the immune system to prevent self-destruction (the others being clonal deletion and immunoregulation).

[0025] "BCL6" means B-cell lymphoma 6 protein that in humans is encoded by the BCL6 gene. It is an evolutionarily conserved zinc finger transcription factor and contains an N-terminal POZ/BTB domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the STAT-dependent Interleukin 4 (IL-4) responses of B cells. This BCL6 gene is found to be frequently translocated and hypermutated in diffuse large B cell lymphoma (DLBCL), and contributes to the pathogenesis of DLBCL.

[0026] "SOCS l" means suppressor of cytokine signaling 1 protein that in humans is encoded by the SOCSl gene. SOCSl includes orthologs that have been identified in several mammals for which complete genome data are available. SOCS l is also referred to as CIS l; CISH1; JAB; SOCS-1; SSI-1; SSIl; and TIP3]. SOCS l is known as a negative regulator of cytokine signaling through STATl (23, 31). SOCS l is known as a negative regulator of cytokine signaling through STATl (23, 31) while dual specificity phosphatases acting on the MAP kinase pathways play a role in inhibition of TCR signaling (32).

[0027] "DUPS 10" means dual specificity protein phosphatase 10, an enzyme that in humans is encoded by the DUSP10 gene. Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phospho serine/threonine and phosphotyrosine residues. They negatively regulate members of the MAPK superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Three transcript variants encoding two different isoforms have been found for this gene and are included herein a

DUPS 10. [0028] "Administering" shall mean delivering in a manner which is affected or performed using any of the various methods and delivery systems known to those skilled in the art. Administering can be performed, for example, topically, intravenously, pericardially, orally, via implant, transmucosally, transdermally, intramuscularly, subcutaneously, intraperitoneally, intrathecally, intralymphatically, intralesionally, or epidurally. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.

[0029] "Abnormally low" or "abnormally high" immune response means a level that is either lower or higher than desired for the subject's health; below normal or above normal. A subject in need of immunosuppression is a subject that has an abnormally high immune response, such as is seen in transplant rejection, autoimmune diseases, graft vs. host disease, inflammation and sepsis; transplant recipients, even prior to having detectable levels of rejection. A subject in need of immuno stimulation is a subject that has an abnormally low immune response, such as an

Im mune deficiency disease including HIV/ AIDS, or iatrogenic immunosuppression or chronic fatigue syndrome or any disorder associated with a low level of activated T cells.

[0030] "MiR" also "micro RNA" means a newly discovered class of small non-coding RNAs that are key negative regulators of gene expression. Like conventional protein-encoding RNA, miRs are transcribed by RNA polymerase II and their expression is controlled by transcriptional factors. The mature miRs inhibit target mRNA translation or promote their degradation by directly binding to specific miR binding sites in the 3 '-untranslated region (3' UTR) of target genes (reviewed in 13).

[0031] "ILT3Fc" is a potent immunosuppressive agent that includes the extracellular domain of ILT3 (which includes the ILT3 ligand binding site) bound to Fc that specifically targets activated T cells which it converts into T suppressor cells.

[0032] The "Extracellular domain of ILT3" shall mean the N-terminal 258 amino acid residues of ILT3 (e.g. , human ILT3 having the sequence of GenBank Accession No. U82979).

[0033] "ILT3" shall mean "Immunoglobulin-Like Transcript-3", and is synonymous with "ILT- 3", "LIR-5", "CD85K" and "LILRB4." The mRNA coding sequence for human ILT3 is provided under GenBank No. U82979. [0034] "Inhibiting" the onset of a disorder shall mean either lessening the likelihood of the disorder's onset, or preventing the onset of the disorder entirely. In the preferred embodiment, inhibiting the onset of a disorder means preventing its onset entirely.

[0035] "Mammalian cell" shall mean any mammalian cell including, without limitation, cells which are normal, abnormal and transformed, and are exemplified by T cells and immune cells.

[0036] "Nucleic acid" shall mean any nucleic acid molecule, including, without limitation, DNA, RNA and hybrids (chimeras) thereof. The nucleic acid bases that form nucleic acid molecules can be the bases A, C, G, T and U, as well as derivatives or modifications thereof. Derivatives of these bases are well known in the art, and are exemplified in PCR Systems, Reagents and Consumables (Perkin Elmer Catalogue 1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J., USA). Nucleic acids in the context of this invention include

"oligonucleotides," which refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. DNA/RNA chimeras are also included.

[0037] "Polypeptide" and "protein" are used interchangeably herein, and each means a polymer of amino acid residues. The amino acid residues can be naturally occurring or chemical analogues thereof. Polypeptides and proteins can also include modifications such as

glycosylation, lipid attachment, sulfation, hydroxylation, and ADP-ribosylation.

[0038] "Prophylactically effective amount" means an amount sufficient to inhibit the onset of a disorder or a complication associated with a disorder in a subject.

[0039] "Subject" shall mean any organism including, without limitation, a mammal such as a mouse, a rat, a dog, a guinea pig, a ferret, a rabbit and a primate. In the preferred embodiment, the subject is a human being. [0040] "Transplant rejection" shall mean the adverse response by the immune system of a subject who has received a transplant (e.g., of an organ or tissue). Transplanted organs in this context include, for example, heart, kidney, skin, lung, liver, eye and bone. Transplanted tissue in this context includes, for example, vascular tissue.

[0041] "Treating" a subject afflicted with a disorder shall mean causing the subject to experience a reduction, remission or regression of the disorder and/or its symptoms.

[0042] "Regulatory T cells (T_reg)", herein also known as "T suppressor cells", are a

subpopulation of T cells which downregulates the immune system, maintains tolerance to self- antigens, and downregulates autoimmune disease. Mouse models have suggested that T suppressor cells can treat autoimmune disease and cancer, and facilitate organ transplantation.

[0043] "Sample" as used herein shall mean any biological specimen obtained from a subject, preferably a serum specimen.

[0044] "Subject" as used herein shall mean an organism that is an object of a method or material, including mammals, e.g., humans, dogs, cows, horses, kangaroos, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. Synonyms used herein include "patient" and "animal."

[0045] "Treating" as used herein shall mean taking steps to obtain beneficial or desired results, including clinical results, such as alleviating or ameliorating one or more symptoms of a disease; diminishing the extent of disease; delaying or slowing disease progression; ameliorating and palliating or stabilizing a metric (statistic) of disease. "Treatment" refers to the steps taken.

[0046] "Heart allograft" as used herein shall mean heart transplant wherein the donor and the recipient are of the same species; i.e. human to human.

[0047] "Grade 2R/3A rejection" shall mean herein that in Grade 2 R/3A, two or more foci of mononuclear cells (lyraphocytes/macrop ages) with associated myocyte damage are present. Eosinophils may be present. The foci may be distributed in one or more than one biopsy fragment. Intervening areas of uninvolved myocardium are present between the foci of rejection. Reference: Stewart S, Winters GL, Fishbein MC, et al. Revision of the 1990 working formulation for the standardization of nomenclature in the diagnosis of heart rejection, j Heart Lung Transplant. 2005;24: 1710-1720.

Background

[0048] ILT3 has been shown to induce immune suppression by inducing T cell anergy, inhibiting the proliferation of T cells and inducing the differentiation of CD8+ T suppressor cells (hereafter also T_reg cells) that mediate immunologic tolerance. Suciu-Foca, US Serial No.

11/661,877. It has now been discovered that ILT3 induces the formation of T suppressor cells by down-regulating the expression of two or more proinflammatory micro RNAs (herein also miR) including miR-30b that targets mRNA encoding BCL6, the gene which is crucial to the generation of CD8+ T suppressor cells; miR-155 that targets SOCS 1 mRNA† miR-21 that targets DUSP10 mRNA and miR- 146a that targets CXCR4 mRNA. It was not known until now that miR-21 targets DUSP10 mRNA suppressing its expression by interfering with translation.

Importantly, it has now been discovered that combinations of two or more of these miRs act in concert to reduce the formation of suppressor T cells, thereby preventing T cell anergy, and maintaining a strong immune response. Therefore simultaneously blocking two or more of miR- 21, miR-30b, miR-146a and miR-155, increases expression of the respective targeted proteins BCL6, SOCS 1, DUSP10 and CXCR4, even in the absence of ILT3.

Embodiments of the Invention

[0049] miRs are known to bind to the 3 '-untranslated region (UTR) of the respective targeted mRNA thereby downregulating expression of the encoded protein. Although each single micro RNA acts simultaneously on hundreds of target genes, It has now been discovered that inhibition of two or more specific inflammatory miRs (21, 30b, 146a and 155) suppresses T cell proliferation, promotes T cell anergy or induces the formation of suppressor T cells, thereby providing a focused therapy with minimal toxicity for disorders associated with abnormally high immune responses. The reverse corollary facilitates methods for immuno stimulation.

[0050] As is described in the Summary of the Invention, some embodiments are directed to methods for treating a subject with an abnormally high immune response. Such a subject is in need of immunosuppression and includes those having graft versus host disease, an autoimmune disease, inflammation, those having received an organ transplant even if they show no signs of rejection, and those undergoing transplant rejection, by administering therapeutically effective amounts of immunosuppressive agents as described herein, including immunosuppressive oligonucleotides that inhibit expression or biological activity of at least two of the miRs: 21, 30b, 146a and 155, hereafter "the targeted miRs" or two or more of the immunosuppressive proteins BCL6, SOCS 1, DUSP10 and CXCR4, or combinations of inhibitory oligonucleotides and proteins.

[0051] Immunosuppressant oligonucleotides comprising the 3'UTR binding site compete with the endogenous miR binding sites in the UTRs on the target proteins for binding to the miRs, thereby reducing the number of miRs that bind to the actual mRNA encoding the respective target protein. Some of these oligonucleotides are described in the Examples and are available commercially.

[0052] Some of the immunosuppressive proteins are known to be low in certain diseases. For example SOCS 1 has been reported to be low in the autoimmune diseases rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE) (Isomaki P et al, 2007, Rheumatology (oxford) 46, 1538-1546 and Chan HC et al, 2010, Lupus 19:696-2702). Diabetic nephropathy in aging mice (Wu J et al Am J Physiol Renal Physiol. 2009 Dec; 297(6):F1622-31.) was shown to be associated with low expression of DUSP10 (MKP5). In treating subjects diagnosed with one of these conditions, the miR that is blocking expression of the respective protein, should be one of the at least two miRs that are inhibited with an immunosuppressive agent. Thus when treating RA or SLE, miR-155 that targets the SOCS 1 gene should be one of the two or more miRs that is targeted for inhibition, and diabetic nephropathy patients can be treated by targeting miR-21 that targets the DUSP10 gene as one of the two or more miR that are inhibited.

[0053] In some other embodiments the method further include administering ILT3, or a fragment of ILT3 that includes the extracellular domain (either by itself or bound to Fc (ILT3Fc) or other molecule that increases the stability or biological activity of the ILT fragment), to increase expression of the immunosuppressive proteins BCL6, SOCS 1, DUSP10 and CXCR4.

[0054] Subjects receiving a transplant require immunosuppression, therefore the methods described herein for treating a subject having an abnormally high immune response, can prevent or delay the onset of transplant rejection, or treat subjects undergoing transplant rejection. The prophylactic and therapeutic doses may be determined by routine experimentation and therapeutically effective amounts given to subjects who display signs of transplant rejection may be higher than amounts given prophylactically. Similarly, the therapeutic amounts for a subject that has a strong rejection of the transplant (i.e., a high grade of rejection) may be higher than the amount administered to a subject with a mild low grade rejection.

[0055] Subjects with abnormally high immune responses can also be treated with ex vivo therapy by isolating T cells from the patient, inducing them to differentiate into T suppressor cells, and reintroducing the T suppressor cells back into the subject in therapeutically effective amounts. The isolated T cells are contacted ex vivo with immunosuppressive agents that reduce the expression or biological activity of at least two miRs (30b, 155, 146a and 21, in an amount that induces the T cells to differentiate into T suppressor cells. Once it has been determined that the T cells have differentiated into T suppressor cells, they are reintroduced into the subject in a therapeutically effective amount that reduces the abnormally high immune response, thereby treating the disorder. In these methods the T cell is a CD4+ T cell, a CDS+ T cell, or a CD8+ T cell.

[0056] The corollary of this discovery is that increasing expression or biological activity of two or more of miR-30b, miR-155, miR-146a, and miR-21, or otherwise blocking expression of the respective targeted proteins BCL6, SOCS 1, CXCR4, or DUSP10, will increase the immune response. Thus another set of embodiments includes increasing the immune response in a subject who has an abnormally low immune response by administering a therapeutically effective amount of immunostimulatory agents as defined herein, including (i) two or more, preferably all, of the miRs selected from the group consisting of miR-30b, miR-146a, miR-155 and miR-21; (ii) two or more gene- specific, chemically- stabilized, double-stranded RNA oligomers, that mimic the function of endogenous mature miRs (miR mimics) selected from the group consisting of miR-30b, miR-146a, miR-155 and miR-21, or (iii) agent(s) such as inhibitory oligonucleotides that reduce the expression of the two or more proteins selected from the group consisting of BCL6, SOCS 1, CXCR4, and DUSP10 proteins. [0057] An embodiment is further directed to a method for inducing T cells to differentiate into T suppressor cells by inducing anergy in a T cell (including a CD4+ T cell or a CD8+ T cell) in vitro or in vivo. This can be accomplished by contacting T cells (preferably isolated from a subject in need of immunosuppression) with immunosuppressive agents, that reduce the expression or biological activity of at least two miRs selected from the group consisting of miR 30b, miR 155, miR-146a and miR 21, under conditions permitting priming of the T cell to occur, thereby inducing anergy in the T cell (such as a CD4⁺ T cell, a CD3⁺ cell or a CD8⁺ T cell) and causing it to differentiate into a regulatory T cell/T suppressor cell. In an embodiment the conditions permitting priming to occur comprise contacting the T cell with an allogeneic antigen presenting cell (APC) or with an autologous APC pulsed with a desired antigen. Exemplary antigen presenting cells include dendritic cells, monocytes, macrophages, endothelial cells and epithelial cells. Determining the differentiation of a T cell into a regulatory T cell is

accomplished, for example, by detecting expression of a regulatory T cell marker or assaying capability of the T cell to inhibit a mixed lymphocyte response to allogeneic APC or to autologous APC pulsed with a desired antigen.

[0058] Certain embodiments of the invention provide pharmaceutical compositions comprising the immunosuppressive or immuno stimulatory agents described herein. In preferred

embodiments, the pharmaceutical formulations comprise therapeutically effective amounts of active oligonucleotides encapsulated in nanoparticles or liposomes.

[0059] Exosomes and other vectors can be used therapeutically to deliver the

immunosuppressive and immuno stimulatory agents that can modify gene expression in a recipient cell.

Overview

[0060] The induction of antigen specific T suppressor cells from primed lymphocytes is a complex process which limits the "collateral damage" resulting from protective immunity and inflammatory responses against self and non-self antigens. T suppressor cells (also called regulatory T cells (T_reg)) are a specialized subpopulation of T cells that suppress activation of the immune system thereby maintaining tolerance to self-antigens. There is ample evidence that dendritic cells (DC) can prevent and inhibit T cell mediated effector responses thereby creating tolerance and inducing anergy, or the DC can instruct T cells to become suppressor/regulatory cells (1). Nontoxic therapeutic approaches for inducing T cells to become suppressor cells are needed to treat patients with abnormally strong immune responses, such as those having autoimmune diseases, patients who have undergone an organ transplant, and those who have developed graft versus host disease.

[0061] It is well established that inhibitory molecules expressed by antigen presenting cells have important roles in the induction of regulatory/suppressor T cells which inhibit inflammatory responses. ILT3 is a prototype of such inhibitory molecules which is characteristically increased on the membrane of human tolerogenic DC and induces the differentiation of human T cells into T suppressor cells. Adaptive T suppressor cells, in turn, induce the upregulation of ILT3 on dendritic cells that in turn trigger the differentiation of new waves of antigen specific T suppressor cells. Gene profile analysis of CD8⁺ T cells primed in mixed lymphocyte culture (MLC) in the presence or absence of ILT3Fc showed that several hundred genes belonging to more than 28 gene ontology categories were modulated (12). However, it was not known until now which ones were important in inducing T cell anergy or the formation of suppressor T cells, and that downregulation of miRs targeting some of these genes is crucial for T suppressor cell differentiation.

[0062] The human immunoglobulin like transcript (ILT) 3 and 4, also known as LIRB4/LIR5/CD85k and LIRB2/LIR2/CD85D, belong to a family of innate immune receptors which are expressed by DC and monocytes (2). These ILT receptors display a long cytoplasmic tail containing immunoreceptor tyrosine-based inhibitory motifs (ITIMs) that mediate inhibition of cell activation by recruiting tyrosine phosphatase SHP-1, and an extracellular domain that contains the ILT3 ligand binding site. (2). Tolerogenic human DC are characterized by high expression of ILT3/ILT4 on their membrane and by their capacity to induce T cell anergy and the differentiation of regulatory/suppressor T cells (3,4). In contrast, knockdown (KD) of ILT3 from DC (ILT3 KD-DC) increases their TLR responsiveness (8), as reflected in synthesis and secretion of proinflammatory cytokines (IL-1 alpha and beta, IL-6 and type I IFN) and migration factors CXCL10 and CXCL11. ILT3 KD-DC enhance T cell proliferation and secretion of IFN-g and IL-17 when pulsed with CMV or used as alio stimulators in MLC (8). [0063] The extracellular domain of ILT3 retains the T cell inhibitory function even upon deletion of the cytoplasmic, ITIM-containing tail, since DC transfected with a construct comprising only the extracellular portion were still capable to elicit the differentiation of CD8+ T suppressor cells (9). A soluble form of ILT3 comprising the extracellular domain expressed as an ILT3Fc fusion protein retains immunomodulatory activity. This recombinant protein inhibited primary and secondary T cell responses in MLC and blocked the differentiation of CD8⁺ cytotoxic T cells (CTL). Furthermore, it elicited the in vitro and in vivo differentiation of CD8⁺ T suppressor cells, which produced no cytokines, inhibited T cell reactivity and induced the upregulation of ILT3 on priming APC (9). In vivo ILT3Fc induced tolerance to allogeneic human pancreatic islet cells transplanted in humanized diabetic NOD/SCID mice (10,11).

[0064] Gene profile analysis of CD8⁺ T cells primed for 7 days in MLC in the presence or absence of ILT3Fc showed there was a striking increase in the expression of transcription factors belonging to a class of zinc finger transcriptional repressors including BCL6, a known inhibitor of IFN-gamma, IL-2, IL-17, IL-5 and granzyme B expression (11, 12). BCL6 was found to be crucial to CD8 T suppressor cell function since knock-down of BCL6 from unprimed human CD8 T cells prevented their differentiation into T suppressor cells while transfection of BCL6 in primed CD8⁺ T cells resulted in the acquisition of T suppressor cell function. High expression of BCL6 was also found in humanized mice tolerating islet allografts. Other genes strongly upregulated by ILT3Fc included DUSP8, DUSP10, TGFBR2, TOB1, CXCR4, ADRB2, and SOCS 1, genes that are known to be involved in functional differentiation of T (12).

Table I: ILT3Fc inducible genes contain potential binding sites for miRs which are inhibited by ILT3Fc

Summary of Results

[0065] The results herein show that certain micro RNAs that target BCL6, SOCS l, DUSP1, DUSP8, DUSPIO, and CXCR4 mRNA are inhibited by ILT3 which binds to the AP-1 promoter region of the miR, and such inhibition induces T cells to differentiate into T suppressor/T regulatory cells with the above-described therapeutic implications.

[0066] Initial experiments showed that membrane and soluble ILT3FC inhibit the expression of proinflammatory miR expression in allo-antigen stimulated T cells. FIG 1A AND IB. Details are set forth in Example I. Computer aid searches for putative targets of these miRs showed that many of them were mRNAs transcribed from genes whose expression was upregulated (>3.0 fold) in CD8⁺ T cells allostimulated in the presence of ILT3Fc, compared to unstimulated controls (11,12). Table I shows a partial list of ILT3Fc-upregulated genes encoding mRNAs whose 3'UTRs contain target sites for these ILT3Fc modulated miRs. Among genes

dramatically upregulated by ILT3Fc were BCL6, SOCS l, CXCR4 and DUSPIO that are integral to the signature of ILT3Fc-induced CD8+ Ts. Proteins encoded by these genes are known inhibitors of cytokine production and T cell receptor (TCR) signaling and they are targeted by miRs that are suppressed by ILT3Fc. FIG 2. Example II.

[0067] BCL6, SOCS l and DUSPIO expression in CD8⁺ T cells was analyzed by transient transfection of either gene specific-, chemically stabilized-, double stranded-RNA oligomers, that mimic the function of endogenous mature miR (miR mimetics- these function as

immuno stimulatory agents) or chemically-modified, single- stranded antisense oligomers that inhibit miR function (miR hairpin inhibitor-these are immunosuppressive agents). FIG 3. These oligonucleotides can be used in the context of the present embodiments. Stability-enhanced miR- 30b RNA oligonucleotide (miRIDIAN Mimic-30b) and miR- 155 oligonucleotide (miRIDIAN Mimic- 155), along with hairpin RNA inhibitors (meridian hairpin inhibitor miR-30b, miR- 155) and the control non-targeting RNA oligonucleotide (miRIDIAN Mimic Negative Control #1) were purchased from Dharmacon. Mimics of miRs 146a and 21 and hairpin RNAs that inhibit miRs 146a and 21 can similarly be ordered commercially. [0068] The data indicated that mRNA encoding BCL6, SOCS l, CXCR4 and DUSPIO are direct targets of post-transcriptional regulation mediated by miR-30b, miR-146a, miR-155, and miR- 21, respectively. Hence, down-regulation of these miRs by ILT3Fc in primed CD8+ T cells prevents the miRs from blocking translation of mRNA encoding proteins transcribed by genes that are induced by ILT3Fc.

[0069] The 3' UTRs of mRNAs encoding BCL6, SOCS l, DUSPIO and CXCR4 (hereafter the target miRs) comprise target binding sites for miR-30b, miR-155 and miR-21 and 146a, respectively. RT-PCR and 3' UTR reporter assays demonstrated that the expression of BCL6, SOCS l, and DUSPIO was upregulated by ILT3Fc, in conjunction with the downregulation of the corresponding miRs that target them. FIG 2. Further, if the 3' UTR recognition sequences were mutated in the ILT3Fc-inducible genes BCL6, SOCS l and DUSPIO, the respective miRs were unable to bind to the mRNA to inhibit translation. FIG. 3.

[0070] Example IV shows the results of experiments proving that the API or NF-kB binding sites within the promoter region of the miR genes encoding miR-21, -146a or -155 were crucial to the inhibitory effect of ILT3Fc. FIG 5B. These results showed that ILT3Fc-induced generation of T suppressor cells is due to inhibition of the miR genes encoding the proinflammatory miRs - 30b, -146a, -155, and -21, and not to direct upregulation of the genes encoding the proteins BCL6, SOCS l, CXCR4 and DUSPIO that are targeted by these miRs.

[0071] Cell proliferation assays showed that adding CD8+ T cells transfected with a single hairpin inhibitor of either miR-21, miR-155 or miR- 146a to CD4 T cells did not inhibit T cell proliferation compared to controls. FIG 5. However, inhibition of at least two of these three miRs tested (21, 30b and 155) did in fact significantly inhibit proliferation. Optimal suppression was achieved with inhibition of all three miRs. FIG 4, Example III. The greatest suppression was seen with ILT3Fc about 78%. By contrast, suppression of only two miRs (either miR-30b and miR-21 or miR-21 and miR-155) reduced the immune response by about 43%; and suppression of three miRs, mir-30b, mir-21 and mir-155, improved suppression to a level of about 59%. It is expected that inhibition of all 4 miRs would have elicit more immune suppression.

[0072] The present invention provides embodiments of methods of treating immune disorders by modulating the expression of a target polynucleotides (mRNA, miR) or a polypeptides BCL6, SOCS 1, DUSP10 and CXCR4 (hereafter the target peptides). These methods generally comprise contacting a cell in vivo or in vitro with an immunosuppressive or immunostimulatory agent capable of modulating the expression of two or more of the target peptides. As used herein, the term "modulating" refers to altering the expression of a target polynucleotide or polypeptide. In different embodiments, modulating can mean increasing or enhancing, or it can mean decreasing or reducing. Methods of measuring the level of expression of a target polynucleotide or polypeptide are known and available in the arts and include, e.g., methods employing reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemical techniques. In particular embodiments, the level of expression of a target polynucleotide or polypeptide is increased or reduced by at least 10%, 20%, 30%, 40%, 50%, or greater than 50% as compared to an appropriate control value.

Heart Allo raft Rejection

[0073] MicroRNAs (miRNAs; miRs) regulate the expression of certain genes implicated in adaptive immunity. It has been shown by others that there is an association with alterations in miRNA expression within and acute rejection in renal allografts. There was a strong association between intragraft expression of miRNAs and messenger RNAs (mRNAs), and both AR and renal allograft function could be predicted with a high level of precision using intragraft levels of miRNAs. Dany Anglicheau, PNAS March 31, 2009 vol. 106 no. 13 5330-5335; MicroRNA expression profiles predictive of human renal allograft status. Because MiRNA expression patterns and levels are highly regulated in concert with lymphocyte differentiation and activation, it has been proposed that changes in miRNA expression may underlie these patterns.

[0074] Heart allografts are a very common treatment for heart disease. At present, repetitive invasive heart biopsies are the only way to determine if a recipient is rejecting the transplant. Thus there is a need for non-invasive methods of monitoring rejection. It has now been discovered that there is a strong, significant positive correlation between elevated miR21 levels in post-transplantation serum samples of heart allograft recipients who are undergoing a grade 2R/3A rejection, compared to pre-transplantation serum miR21 levels.

[0075] The relationship between the development of a grade 2R/3A rejection diagnosed by examination of lymphocytic infiltrations in heart allograft biopsies, and serum levels of miR21 in sequential samples of sera obtained from 12 recipients. There was an average of 5 serum samples per patient.

[0076] There was a highly significant correlation between grade 2R/3A rejection and elevated serum miR21 in post- transplantation samples compared to the baseline miR21 level established in a pre-transplantation serum sample from each of the 12 recipients. (p<0.0001). Serum specimen with 40% of more up-regulation of miR21 from baseline is considered to be positive.

[0077] The correlation of serum miR levels with biopsy results are shown in Table 1. 63 serum samples were analyzed from 12 patients. 4 of the 12 patients had positive biopsy grade 2R/3A results indicating rejection (one of the patients had two episodes of 2R/3A rejections); 8 patients had negative biopsies.

[0078] The mir21 data summarized in Table 1 shows that none of the 7 patients with negative biopsies had elevated serum miR21 levels in post-transplantation samples. By contrast, 4 out of the 5 patients who had positive biopsies for grade 2R/3A rejection had significantly elevated post-transplantation serum miR21 compared to their respective pre-transplant level. Thus, the Positive Predictive Value (PPV) for grade 2R/3A rejection in 4/4 samples showing elevated serum miR21 was 100%. The sensitivity level for a diagnostic test for grade 2R/3A rejection based on elevated miR in 4/5 patients was 80% (i.e. 1 of the 5 serum samples from patients known to have grade 2R/3A rejection did not have elevated miR21). Thus, reliance on serum miR21 levels to diagnose grade 2R/3A rejection, would have a false negative rate of 20%, based on these results. The negative predictive value (58/59) was 98%.

Individual patient data is presented in TABLE 2. TABLE 1 12 patients

Total 5 58 63

Correlation coefficient P<0.0001

Positive Predictive Value 4/4=100%

(PPV)

Negative Predictive Value 58/59=98%

(NPV)

Sensitivity 4/5=80%

Specificity 58/58=100%

Table 2

ID Age Sex Days post-transplantation (% up-regulation, Bispsy Grade)

1 65 M Day 7 (40%, 2R/3A), Day 29 (0%, 0), Day 43 (0%, 1R/1A),

Day 57 (0%, 1R/1A), Day 168 (0%, 0), Day 279 (0%, 0)

2 49 F Day 9 (0%. 1R/1A), Day 25 (0%, 1R/1A), Day 32 (0%, 0),

Day 86 (0%, 0), Day 170 (0%, 0)

3 38 M Day 14 (0%, 0), Day 22 (0%, 0), Day 65 (0%, 1R/1A),

Day 105 (0%, IR/IA), Day 197 (0%, 0)

4 57 M Day 6 (0%, IR/IA), Dayl2 (0%, 2R/3A), Day 27 (0%, IR/IA),

Day 42 (41%, 2R/3A), Day 54 (0%, 1R/1A), Day 69 (0%, 1R/1A)

5 60 M Day 7 (0%, 0), Day 19 (0%, 0), Day 38 (0%, 0),

Day 164 (0%, IR/IA)

6 62 M Day 32 (0%, 0), Day 94 (116%, 2R/3A), Day 113 (0%, 0)

7 58 M Day 8 (0%, 0), Day 22 (14%, 0), Day 42 (0%, 0), Day 80 (0%, 0),

Day 143 (0%, IR/IA)

8 50 F Day 5 (0%, IR/IB), Day 12 (0%, IR/IB), Day 33 (0%, 0),

Day 54 (0% 1R/1A), Day 85 (0%, 1R/1B), Day 179 (0%, 1R/1B), Day 196 (0%, 0)

9 47 M Day 12 (0%, 0), Day 37 (0%, 0), Day 110 (0%, 0), Day 143 (0%, 0)

10 50 M Day 9 (0%, IR/IA), Day 32 (0%, 0), Day 53 (0%, 0),

Day 165 (25%, 0), Day 275 (2%, 0), Day 427 (24%, 0) 11 60 M Day 25 (0%, 0), Day 46 (0%, 0), Day 172 (0%, 0),

Day 261 (0%, 0), Day 350 (0%, 0), Day 449 (6%, 0)

12 64 M Day 16 (0%, 0), Day 46 (0%, 1R/1A), Day 88 (0%, 1R/1A),

Day 123 (0%, 0), Day 163 (0%, 1R/1A), Day 226 (54%, 2R/3A)

[0079] The results indicate that the development of acute rejection episodes, which require immediate treatment, has a high statistical correlation with inflammatory changes reflected in the increase of miR21 expression and its release into the circulation.

[0080] Based on these observations, certain embodiments are directed to diagnosing grade 2R/3A rejection in a heart allograft recipient by determining if there is a significant increase in serum miR21 after transplantation compared to pre-transplant serum miR21 levels. In the methods for diagnosing acute cellular rejection of a heart allograft in a patient based on increased amounts of serum micro RNA 21 after transplantation compared to the patient's pre- transplantation levels.

[0081] An embodiment is directed to a method for diagnosing grade 2R/3A rejection of a heart allograft in a subject by obtaining a pre-allograft serum sample and a post-allograft sample and determining if the miR21 level in the pre-allograft sample is more than about 20% higher than the miR21 level in the post-allograft sample, and if it is then determining that the subject has a grade 2R/3A rejection. The above embodiment can further comprise e) performing a biopsy to confirm the diagnosis of 2R/3A rejection, and f) treating the subject for 2R/3A rejection.

Pharmaceutical formulations and administration

[0082] As used herein, "isolated nucleic acid" refers to a nucleic acid that is separated from other nucleic acid molecules that are present in a mammalian genome, including nucleic acids that normally flank one or both sides of the nucleic acid in a mammalian. The term "isolated" as used herein with respect to nucleic acids also includes any non-naturally-occurring nucleic acid sequence, since such non-naturally-occurring sequences are not found in nature and do not have immediately contiguous sequences in a naturally- occurring genome. All of the

immuno stimulatory and immunosuppressive nucleic acids and proteins used in embodiments of the present invention are isolated nucleic acids. Recombinant oligonucleotides and proteins are preferred for use in the present embodiments.

[0083] In an embodiment, various combinations of immunosuppressive nucleic acids are made, such that the level of expression of at least two of the targeted miRs is increased to a level that achieves the desired therapeutic result.The immunosuppressive oligonucleotides are formulated in therapeutic amounts for delivery to a subject, preferably a human.

[0084] In an embodiment, oligonucleotides are incorporated into nanoparticles for delivery intravenously for example via the Rondel™ delivery system. In another embodiment the oligonucleotides are formulated in lipid-based carrier systems. Determination of a preferred pharmaceutical formulation and a therapeutically efficient dose regimen for a given application is within the skill of the art taking into consideration, for example, the condition and weight of the patient, the extent of desired treatment and the tolerance of the patient for the treatment.

[0085] Immuno stimulatory agents are formulated in combinations that raise the level of at least two of miRs (30b, 21, 146a and 155) (or miR mimetics) or lower the level of targeted peptides to therapeutically effective levels.

[0086] siRNAs Oblimersen (Genasense) has been given to patients for up to six cycles of 7 days at a 3 mg/kg/day dose with no severe adverse effects. Oligonucleotides are relatively safe, and have been administered at doses of up to 15 mg/kg to non-human primates. Webb MS, et al. Antisense Nucleic Acid Drug Dev. 2001 ;11: 155; O'Brien S, et al. J. Clin. Oncol. 2007;25: 1114.

[0087] Recently targeted delivery of effective, functional siRNA to human tumors was tested on metastatic melanoma patients. CALAA-01 siRNA targeting the M2 subunit of ribonucleotide reductase, a clinically-validated cancer target was administered intravenously in nanoparticles using the RONDEL™ delivery system. NATURE Vol 464, 15 April 2010, pi 067. Patients with solid refractory cancers received 4 i.v. infusions (30 min) on d 1, 3, 8, and 10 of 21-d cycles. CALAA-01 nanoparticles consisted of a cyclodextrin-based polymer, transferrin protein (hTf) targeting ligand, polyethylene glycol (PEG) for stability, and siRNA against ribonucleotide reductase M2 (RRM2). The 70 nm particles were designed to minimize renal clearance and allow tumor vasculature permeation with binding to tumor hTf receptors (TfR). 15 pts accrued to 5 dose levels (3, 9, 18, 24, 30 mg/m²Journal of Clinical Oncology, 2010 ASCO Annual Meeting Proceedings (Post-Meeting Edition),Vol 28, No 15suppl (May 20 Supplement), 2010: 3022. This is the first demonstration in humans of targeted siRNA-containing nanoparticle delivery to tumors using systemic administration, delivery of functional siRNAs, and achievement of specific mRNA and protein reductions via RNAi. No significant drug-related toxicities, known as serious adverse events (SAEs), have been observed that may limit use.

[0088] In preferred embodiments, the immunostimulatory and immunosuppressive agents are delivered in nanop articles, for example using the RONDEL™ delivery system and infused into the bloodstream of patients. In the RONDEL system, siRNA is encapsulated in cyclodextrin- containing polymers and thus can reach its destination and perform its intended function. By encapsulating the siRNA, RONDEL protects the siRNA from degradation and also protects the body from the immune reactions that may be caused by naked siRNA. The siRNA delivery system has been designed for intravenous injection. Ribas, A., L. et ah, (2010) J Clin Oncol 28(15s): abstr 3022; Heidel, et al, (2010) Pharm Res: 12 June.

[0089] In a set of embodiments, the therapeutically effective amount of an immunosuppressive or immunostimulatory oligonucleotide, is between about 0.1 mg/kg and about 50 mg/kg, and is delivered for example, intravenously. MOLECULAR THERAPY Vol. 13, No. 4, April 2006. In an embodiment, the therapeutically or prophylactically effective amount, administered intravenously, is between about 1 mg/kg and about 20 mg/kg. Administration of the therapeutic agents or compositions of this invention, may be accomplished using any of the conventionally accepted modes of administration of similar immunosuppressive or immunostimulatory agents. Depending on the severity and type of disorder, and on the patient, doses may be on the lower or higher end of the spectrum.

[0090] Regarding liposome formulations, Manoharan, US 20120027796 describes administering siRNA systemically in cationic liposomes, and these nucleic acid-lipid particles have been reported to provide improved down-regulation of target proteins in mammals including non- human primates compared to anionic liposomes (Zimmermann et ah, Nature 441: 111-114 (2006)). Recent advances have been made in lipid delivery of therapeutic oligonucleotides via cationic liposomes also called nucleic acid-lipid particle compositions that have low toxicity, increased activity of the nucleic acid and/or improved tolerability of the compositions in vivo, which can result in a significant increase in therapeutic index.

[0091] For in vivo administration, the pharmaceutical compositions are preferably administered parenterally, i.e., intraarticularly, intravenously, intraperitoneally, subcutaneously, or intramuscularly. In particular embodiments, the pharmaceutical compositions are administered intravenously or intraperitoneally by a bolus injection. Stadler, et al., U.S. Pat. No. 5,286,634. Methods of administering lipid-based therapeutics are described in, for example, Rahman et al., U.S. Pat. No. 3,993,754; Sears, U.S. Pat. No. 4,145,410; Papahadjopoulos et al, U.S. Pat. No. 4,235,871; Schneider, U.S. Pat. No. 4,224,179; Lenk et al, U.S. Pat. No. 4,522,803; and Fountain et al, U.S. Pat. No. 4,588,578.

[0092] The pharmaceutical composition typically further comprises a pharmaceutically acceptable diluent, excipient, or carrier, such as physiological saline or phosphate buffer, selected in accordance with the route of administration and standard pharmaceutical practice. Generally, normal saline will be employed as the pharmaceutically acceptable carrier. Other suitable carriers include, e.g., water, buffered water, 0.9% saline, 0.3% glycine, and the like, including glycoproteins for enhanced stability, such as albumin, lipoprotein, globulin, etc. In compositions comprising saline or other salt containing carriers, the carrier is preferably added following lipid particle formation. Thus, after the lipid-nucleic acid compositions are formed, the compositions can be diluted into pharmaceutically acceptable carriers such as normal saline.

[0093] Encapsulated nucleic acids are typically present in a nucleic acid/lipid ratio of about 10 wt % to about 20 wt %. The intermediate mixture may optionally be sized to obtain lipid- encapsulated nucleic acid particles wherein the lipid portions are unilamellar vesicles, preferably having a diameter of 30 to 150 nm, more preferably about 40 to 90 nm. The pH is then raised to neutralize at least a portion of the surface charges on the lipid-nucleic acid particles, thus providing an at least partially surface-neutralized lipid-encapsulated nucleic acid composition.

[0094] Dosages for the lipid-therapeutic agent particles of the present invention will depend on the ratio of therapeutic agent to lipid and the administrating physician's opinion based on age, weight, and condition of the patient. The lipid-nucleic acid particles of the invention can be prepared according to standard techniques. [0095] The resulting pharmaceutical preparations may be sterilized by conventional, well known sterilization techniques. The aqueous solutions can then be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc. Additionally, the lipidic suspension may include lipid-protective agents which protect lipids against free- radical and lipid-peroxidative damages on storage. Lipophilic free-radical quenchers, such as .alpha.-tocopherol and water-soluble iron-specific chelators, such as ferrioxamine, are suitable.

[0096] Lipid-therapeutic agent (e.g. , nucleic acid) particles may include polyethylene glycol (PEG)-modified phospholipids, PEG-ceramide, or ganglioside G.sub.Ml-modified lipids or other lipids effective to prevent or limit aggregation. Addition of such components does not merely prevent complex aggregation. Rather, it may also provide a means for increasing circulation lifetime and increasing the delivery of the lipid-nucleic acid composition to the target tissues.

[0097] The pharmaceutical compositions of this invention may be in a variety of forms, which may be selected according to the preferred modes of administration. These include, for example, solid, semi-solid and liquid dosage forms such as tablets, pills, powders, liquid solutions or suspensions, suppositories, and injectable and infusible solutions. The preferred form depends on the intended mode of administration and therapeutic application. Modes of administration may include oral, parenteral, subcutaneous, intravenous, intralesional or topical administration.

[0098] The compositions of this invention may, for example, be placed into sterile, isotonic formulations with or without cofactors which stimulate uptake or stability. The formulation is preferably liquid, or may be lyophilized powder. For example, the compositions of the invention may be diluted with a formulation buffer comprising 5.0 mg/ml citric acid monohydrate, 2.7 mg/ml trisodium citrate, 41 mg/ml mannitol, 1 mg/ml glycine and 1 mg/ml polysorbate 20. This solution can be lyophilized, stored under refrigeration and reconstituted prior to administration with sterile Water-For- Injection (USP). [0099] The compositions of the present invention can also be formulated so as to provide slow or controlled-release of the active agent(s) therein using, e.g., hydropropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes and/or microspheres. In general, a controlled-release preparation is a composition capable of releasing the active ingredient/therapeutic agent(s) at the required rate to maintain constant

pharmacological activity for a desirable period of time. Such dosage forms can provide a supply of a drug to the body during a predetermined period of time and thus maintain drug levels in the therapeutic range for longer periods of time than other non-controlled formulations.

Therapeutic Oligonucleotides

[0100] The oligonucleotides used as immunosuppressive or immuno stimulatory agents herein are synthesized in vitro and do not include compositions of biological origin. Based on these known sequences of the targeted miRs or mRNA and the genes encoding them, therapeutic oligonucleotides can be engineered using methods known in the art. These oligonucleotides include antisense DNA or RNA (or chimeras thereof), small interfering RNA (siRNA), micro RNA (miRNA), short hairpin RNA, ribozymes, antagomir, antimir, microRNA mimic, supermir, and aptamers. Different combinations of these therapeutic agents can be formulated for administration to a subject using methods well known in the art. Certain embodiments of the present invention involve the therapeutic use of antisense nucleic acids or inhibitory RNAs such as small interfering RNA (siRNA) or short hairpin RNAs (shRNA) to reduce or inhibit expression and hence the biological activity of the certain targeted miRs or mRNA.

[0101] The nucleic acid sequences of the various human miRs suitable for targeting or mimicking are known in the public domain:

Homo sapiens miR-21: NR_029493.1,

Homo sapiens miR-30b: NR_029666.1

Homo sapiens miR146a: NR_029701.1

Homo sapiens miR155: NR_030784.1

[0102] The accession numbers for mRNAs (or cDNAs) encoding the proteins are: BCL6 (NCBI accession: NC_000003.11, Homo sapiens chromosome 3, GRCh37.p5 Primary Assembly)

SOCS 1 (NCBI accession: NC_000016.9, Homo sapiens chromosome 16, GRCh37.p5 Primary Assembly)

CXCR4 (NCBI accession: NC_000002.11, Homo sapiens chromosome 2, GRCh37.p5 Primary Assembly)

and DUSP10 (NCBI accession: NC_000001.10, Homo sapiens chromosome 1, GRCh37.p5 Primary Assembly).

[0103] Therapeutic nucleic acids include, e.g., small interfering RNA (siRNA), micro RNA (miRNA), antisense oligonucleotides, ribozymes, antisense, antagomir, antimir, microRNA mimic, supermir, and aptamer. These nucleic acids act via a variety of mechanisms. siRNA or miRNA can down-regulate intracellular levels of specific proteins through a process termed RNA interference (RNAi). Following introduction of siRNA or miRNA into the cell cytoplasm, these double-stranded RNA constructs can bind to a protein termed RISC. RNA-Induced Silencing Complex, or RISC, is a multiprotein complex that incorporates one strand of a small interfering RNA (siRNA) or micro RNA (miRNA). RISC uses the siRNA or miRNA as a template for recognizing complementary mRNA. When it finds a complementary strand, it activates RNase and cleaves the RNA. This process is important both in gene regulation by microRNAs and in defense against viral infections, which often use double- stranded RNA as an infectious vector.RNAi can provide down-regulation of specific proteins by targeting specific destruction of the corresponding mRNA that encodes for protein synthesis.

[0104] The therapeutic applications of RNAi are extremely broad, since siRNA and miRNA constructs can be synthesized with any nucleotide sequence directed against mRNA encoding a target protein. To date, siRNA constructs have shown the ability to specifically down-regulate target proteins in both in vitro and in vivo models and they are currently being evaluated in clinical studies.

[0105] Antisense oligonucleotides and ribozymes can also inhibit mRNA translation into protein. In the case of antisense constructs, these single stranded deoxynucleic acids have a complementary sequence to that of the target protein mRNA and can bind to the mRNA by Watson-Crick base pairing. This binding either prevents translation of the target mRNA and/or triggers RNase H degradation of the mRNA transcripts. Consequently, antisense

oligonucleotides have tremendous potential for specificity of action (i.e., down-regulation of a specific disease-related protein). To date, these compounds have shown promise in several in vitro and in vivo models, including models of inflammatory disease, cancer, and HIV (reviewed in Agrawal, Trends in Biotech. 14:376-387 (1996)). Antisense can also affect cellular activity by hybridizing specifically with chromosomal DNA. Advanced human clinical assessments of several antisense drugs are currently underway.

[0106] It is desirable to optimize the stability of the phosphodiester internucleotide linkage and minimize its susceptibility to exonucleases and endonucleases in serum. (Zelphati, O., et al., Antisense. Res. Dev. 3:323-338 (1993); and Thierry, A. R., et al, pp 147-161 in Gene

Regulation: Biology of Antisense RNA and DNA (Eds. Erickson, R P and Izant, J G; Raven Press, NY (1992)).

[0107] Therapeutic nucleic acids being currently being developed do not employ the basic phosphodiester chemistry found in natural nucleic acids, because of these and other known problems. Modifications have been made at the internucleotide phosphodiester bridge (e.g., using phosphorothioate, methylphosphonate or phosphoramidate linkages), at the nucleotide base (e.g., 5-propynyl-pyrimidines), or at the sugar (e.g., 2'-modified sugars) (Uhlmann E., et al. Antisense: Chemical Modifications. Encyclopedia of Cancer, Vol. X., pp 64-81 Academic Press Inc. (1997)). Others have attempted to improve stability using 2'-5' sugar linkages (see, e.g., U.S. Pat. No. 5,532,130).

[0108] Immunosuppressant and immuno stimulatory nucleic acids for use in embodiments of the present invention may be of various lengths, generally dependent upon the particular form of nucleic acid, typically from about 10 to 100 nucleotides in length. In various related

embodiments, oligonucleotides, single-stranded, double- stranded, and triple- stranded, may range in length from about 10 to about 50 nucleotides, from about 20 o about 50 nucleotides, from about 15 to about 30 nucleotides, from about 20 to about 30 nucleotides in length. [0109] In particular embodiments, the oligonucleotide (or a strand thereof) specifically hybridizes to or is complementary to a target polynucleotide, preferably an mRNA or miR molecule. "Specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide. It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target interferes with the normal function of the target molecule to cause a loss of utility or expression of the target, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, or, in the case of in vitro assays, under conditions in which the assays are conducted. Thus, in other embodiments, this oligonucleotide includes 1, 2, or 3 base substitutions, e.g. mismatches, as compared to the region of a gene or mRNA sequence that it is targeting or to which it specifically hybridizes.

[0110] Small interfering RNA (siRNA) has essentially replaced antisense ODN and ribozymes as the next generation of targeted oligonucleotide drugs under development. SiRNAs are RNA duplexes normally 16-30 nucleotides long that can associate with a cytoplasmic multi-protein complex known as RNAi-induced silencing complex (RISC). RISC loaded with siRNA mediates the degradation of homologous mRNA transcripts; therefore siRNA can be designed to knock down protein expression with high specificity. Unlike other antisense technologies, siRNA function through a natural mechanism evolved to control gene expression through non-coding RNA. This is generally considered to be the reason why their activity is more potent in vitro and in vivo than either antisense ODN or ribozymes. A variety of RNAi reagents, including siRNAs targeting clinically relevant targets, are currently under pharmaceutical development, as described, e.g., in de Fougerolles, A. et ah, Nature Reviews 6:443-453 (2007).

[0111] While the first described RNAi molecules were RNA:RNA hybrids comprising both an RNA sense and an RNA antisense strand, it has now been demonstrated that DNA sense:RNA antisense hybrids, RNA sense:DNA antisense hybrids, and DNA:DNA hybrids are capable of mediating RNAi (Lamberton, J. S, and Christian, A. T., (2003) Molecular Biotechnology 24: 111-119). Thus, the invention includes the use of RNAi molecules comprising any of these different types of double- stranded molecules. In addition, it is understood that RNAi molecules may be used and introduced to cells in a variety of forms. Accordingly, as used herein, RNAi molecules encompasses any and all molecules capable of inducing an RNAi response in cells, including, but not limited to, double-stranded oligonucleotides comprising two separate strands, i.e. a sense strand and an antisense strand, e.g., small interfering RNA (siRNA); double-stranded oligonucleotide comprising two separate strands that are linked together by non-nucleotidyl linker; oligonucleotides comprising a hairpin loop of complementary sequences, which forms a double-stranded region, e.g., shRNAi molecules, and expression vectors that express one or more polynucleotides capable of forming a double- stranded polynucleotide alone or in combination with another polynucleotide.

[0112] A "single strand siRNA compound" as used herein, is an siRNA compound which is made up of a single molecule. It may include a duplexed region, formed by intra-strand pairing, e.g., it may be, or include, a hairpin or pan-handle structure. Single strand siRNA compounds may be antisense with regard to the target molecule.

[0113] A single strand siRNA compound may be sufficiently long that it can enter the RISC and participate in RISC mediated cleavage of a target mRNA. A single strand siRNA compound is typically at least 14, and in other embodiments at least 15, 20, 25, 29, 35, 40, or 50 nucleotides in length. In certain embodiments, it is less than 200, 100, or 60 nucleotides in length.

[0114] Hairpin siRNA compounds will have a duplex region equal to or at least 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs. The duplex region will may be equal to or less than 200, 100, or 50, in length. In certain embodiments, ranges for the duplex region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length. The hairpin may have a single strand overhang or terminal unpaired region. In certain embodiments, the overhangs are 2-3 nucleotides in length. In some embodiments, the overhang is at the sense side of the hairpin and in some embodiments on the antisense side of the hairpin. [0115] A "double stranded siRNA compound" as used herein, is a siRNA compound which includes more than one, and in some cases two, strands in which interchain hybridization can form a region of duplex structure.

[0116] The antisense strand of a double stranded siRNA compound may be equal to or at least,

14, 15, 16 17, 18, 19, 25, 29, 40, or 60 nucleotides in length. It may be equal to or less than 200, 100, or 50, nucleotides in length. Ranges may be 17 to 25, 19 to 23, and 19 to 21 nucleotides in length. As used herein, term "antisense strand" means the strand of a siRNA compound that is sufficiently complementary to a target molecule, e.g. a target RNA.

[0117] The sense strand of a double stranded siRNA compound may be equal to or at least 14,

15, 16 17, 18, 19, 25, 29, 40, or 60 nucleotides in length. It may be equal to or less than 200, 100, or 50, nucleotides in length. Ranges may be 17 to 25, 19 to 23, and 19 to 21 nucleotides in length.

[0118] The double strand portion of a double stranded siRNA compound may be equal to or at least, 14, 15, 16 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 nucleotide pairs in length. It may be equal to or less than 200, 100, or 50, nucleotides pairs in length. Ranges may be 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length.

[0119] In many embodiments, the siRNA compound is sufficiently large that it can be cleaved by an endogenous molecule, e.g., by Dicer, to produce smaller siRNA compounds, e.g., siRNAs agents

[0120] The sense and antisense strands may be chosen such that the double-stranded siRNA compound includes a single strand or unpaired region at one or both ends of the molecule. Thus, a double- stranded siRNA compound may contain sense and antisense strands, paired to contain an overhang, e.g., one or two 5' or 3' overhangs, or a 3' overhang of 1-3 nucleotides. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. Some embodiments will have at least one 3' overhang. In one embodiment, both ends of a siRNA molecule will have a 3' overhang. In some embodiments, the overhang is 2 nucleotides. [0121] In certain embodiments, the length for the duplexed region is between 15 and 30, or 18, 19, 20, 21, 22, and 23 nucleotides in length, e.g., in the ssiRNA compound range discussed above. ssiRNA compounds can resemble in length and structure the natural Dicer processed products from long dsiRNAs. Embodiments in which the two strands of the ssiRNA compound are linked, e.g., covalently linked are also included. Hairpin, or other single strand structures which provide the required double stranded region, and a 3' overhang are also within the invention.

[0122] The siRNA compounds described herein, including double-stranded siRNA compounds and single-stranded siRNA compounds can mediate silencing of a target RNA, e.g., mRNA, e.g., an mRNA transcript of a gene that encodes a protein. A gene may also be targeted. In general, the RNA to be silenced is an endogenous gene or a pathogen gene. In addition, RNAs other than mRNA, e.g., tRNAs, and viral RNAs, can also be targeted.

[0123] As used herein, the phrase "mediates RNAi" refers to the ability to silence, in a sequence specific manner, a target RNA. While not wishing to be bound by theory, it is believed that silencing uses the RNAi machinery or process and a guide RNA, e.g., an ssiRNA compound of 21 to 23 nucleotides.

[0124] In one embodiment, an siRNA compound is "sufficiently complementary" to a target RNA, e.g., a target mRNA, such that the siRNA compound silences production of protein encoded by the target mRNA. In another embodiment, the siRNA compound is "exactly complementary" to a target RNA, e.g., the target RNA and the siRNA compound anneal, for example to form a hybrid made exclusively of Watson-Crick base pairs in the region of exact complementarity. A "sufficiently complementary" target RNA can include an internal region (e.g., of at least 10 nucleotides) that is exactly complementary to a target RNA. Moreover, in certain embodiments, the siRNA compound specifically discriminates a single-nucleotide difference. In this case, the siRNA compound only mediates RNAi if exact complementary is found in the region (e.g., within 7 nucleotides of) the single-nucleotide difference.

MicroRNAs [0125] Micro RNAs (miRNAs) are a highly conserved class of small RNA molecules that are transcribed from DNA in the genomes of plants and animals, but are not translated into protein. Processed miRNAs are single stranded (about 17-25 nucleotide (nt)) RNA molecules that become incorporated into the RNA-induced silencing complex (RISC) and have been identified as key regulators of development, cell proliferation, apoptosis and differentiation. They are believed to play a role in regulation of gene expression by binding to the 3'-untranslated region of specific mRNAs. RISC mediates down-regulation of gene expression through translational inhibition, transcript cleavage, or both. RISC is also implicated in transcriptional silencing in the nucleus of a wide range of eukaryotes.

Antisense Oligonucleotides

[0126] In one embodiment, a nucleic acid is an antisense oligonucleotide directed to a target polynucleotide. The term "antisense oligonucleotide" or simply "antisense" is meant to include oligonucleotides that are complementary to a targeted polynucleotide sequence. Antisense oligonucleotides are single strands of DNA or RNA that are complementary to a chosen sequence, e.g. a target gene mRNA. Antisense oligonucleotides are thought to inhibit gene expression by binding to a complementary mRNA. Binding to the target mRNA can lead to inhibition of gene expression either by preventing translation of complementary mRNA strands by binding to it or by leading to degradation of the target mRNA Antisense DNA can be used to target a specific, complementary (coding or non-coding) RNA. If binding takes places this DNA/RNA hybrid can be degraded by the enzyme RNase H. In particular embodiment, antisense oligonucleotides contain from about 10 to about 50 nucleotides, more preferably about 15 to about 30 nucleotides. The term also encompasses antisense oligonucleotides that may not be exactly complementary to the desired target gene. Thus, the invention can be utilized in instances where non-target specific-activities are found with antisense, or where an antisense sequence containing one or more mismatches with the target sequence is the most preferred for a particular use.

[0127] Antisense oligonucleotides have been demonstrated to be effective and targeted inhibitors of protein synthesis, and, consequently, can be used to specifically inhibit protein synthesis by a targeted gene. The efficacy of antisense oligonucleotides for inhibiting protein synthesis is well established. See for example (U.S. Pat. No. 5,739,119 and U.S. Pat. No.

5,759,829); (Jaskulski et al, Science. 1988 Jun. 10; 240(4858): 1544-6; Vasanthakumar and Ahmed, Cancer Commun. 1989; l(4):225-32; Penis et al, Brain Res Mol Brain Res. 1998 Jun. 15; 57(2):310-20; U.S. Pat. No. 5,801,154; U.S. Pat. No. 5,789,573; U.S. Pat. No. 5,718,709 and U.S. Pat. No. 5,610,288); (U.S. Pat. No. 5,747,470; U.S. Pat. No. 5,591,317 and U.S. Pat. No. 5,783,683).

[0128] Methods of producing antisense oligonucleotides are known in the art and can be readily adapted to produce an antisense oligonucleotide that targets any polynucleotide sequence.

Selection of antisense oligonucleotide sequences specific for a given target sequence is based upon analysis of the chosen target sequence and determination of secondary structure, binding energy, and relative stability. Antisense oligonucleotides may be selected based upon their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prohibit specific binding to the target mRNA in a host cell. Highly preferred target regions of the mRNA include those regions at or near the AUG translation initiation codon and those sequences that are substantially complementary to 5' regions of the mRNA. These secondary structure analyses and target site selection considerations can be performed, for example, using v.4 of the OLIGO primer analysis software (Molecular Biology Insights) and/or the BLASTN 2.0.5 algorithm software (Altschul et al., Nucleic Acids Res. 1997, 25(17):3389-402).

Antagomirs

[0129] Antagomirs are RNA-like oligonucleotides that have various modifications for RNase resistance and pharmacologic properties, such as enhanced tissue and cellular uptake. They differ from normal RNA by, for example, complete 2'-0-methylation of sugar, phosphorothioate backbone and, for example, a cholesterol-moiety at 3'-end. Antagomirs may be used to efficiently silence endogenous miRNAs by forming duplexes comprising the antagomir and endogenous miRNA, thereby preventing miRNA-induced gene silencing. See, for example, Krutzfeldt et al, Nature, 2005, 438: 685-689, and U.S. patent application Ser. Nos. 11/502,158 and 11/657,341 (re synthesis of antagomirs). [0130] An antagomir can include ligand-conjugated monomer subunits and monomers for oligonucleotide synthesis. Exemplary monomers are described in U.S. application Ser. No. 10/916,185, filed on Aug. 10, 2004. An antagomir can have a ZXY structure, such as is described in PCT Application No. PCT/US2004/07070 filed on Mar. 8, 2004. An antagomir can be complexed with an amphipathic moiety. Exemplary amphipathic moieties for use with oligonucleotide agents are described in PCT Application No. PCT/US2004/07070, filed on Mar. 8, 2004.

Aptamers

[0131] Aptamers are nucleic acid or peptide molecules that bind to a particular molecule of interest with high affinity and specificity (Tuerk and Gold, Science 249:505 (1990); Ellington and Szostak, Nature 346:818 (1990)). DNA or RNA aptamers have been successfully produced which bind many different entities from large proteins to small organic molecules. See Eaton, Curr. Opin. Chem. Biol. 1: 10-16 (1997), Famulok, Curr. Opin. Struct. Biol. 9:324-9 (1999), and Hermann and Patel, Science 287:820-5 (2000). Aptamers may be RNA or DNA based, and may include a riboswitch. Regulatory elements are known as riboswitches and are defined as mRNA elements that bind metabolites or metal ions as ligands and regulate mRNA expression by forming alternative structures in response to this ligand binding (Figure 1 ; Nudler & Mironov 2004; Tucker & Breaker 2005; Winkler 2005). Although they can bind proteins like antibodies, aptamers are not immunogenic, even at doses up to 1000 times the therapeutic dose in primates.

[0132] A riboswitch is a part of an mRNA molecule that can directly bind a small target molecule, and whose binding of the target enables it to regulate its own activity, depending on the presence or absence of its target molecule. Riboswitches are most often located in the 5' untranslated region (5' UTR; a stretch of RNA that precedes the translation start site) of bacterial mRNA. There they regulate the occlusion of signals for transcription attenuation or translation initiation. Edwards, A. L. et al., (2010)Riboswitches: A Common RNA Regulatory

Element.Nature Education3(9):9. [0133] Generally, aptamers are engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. The aptamer may be prepared by any known method, including synthetic, recombinant, and purification methods, and may be used alone or in combination with other aptamers specific for the same target. Further, as described more fully herein, the term "aptamer" specifically includes "secondary aptamers" containing a consensus sequence derived from comparing two or more known aptamers to a given target.

Ribozymes

[0134] According to another embodiment of the invention, targeted mRNA is inhibited by ribozymes, which have specific catalytic domains that possess endonuclease activity (Kim and Cech, Proc Natl Acad Sci USA. 1987 December; 84(24):8788-92; Forster and Symons, Cell. 1987 Apr. 24; 49(2):211-20). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech et ah, Cell. 1981 December; 27(3 Pt 2):487- 96; Michel and Westhof, J Mol. Biol. 1990 Dec. 5; 216(3):585-610; Reinhold-Hurek and Shub, Nature. 1992 May 14; 357(6374): 173-6). This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.

[0135] At least six basic varieties of naturally- occurring enzymatic RNAs are known presently. Each can catalyze the hydrolysis of RNA phosphodiester bonds in trans (and thus can cleave other RNA molecules) under physiological conditions. In general, enzymatic nucleic acids act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.

[0136] The enzymatic nucleic acid molecule may be formed in a hammerhead, hairpin, a hepatitis delta virus, group I intron or RNaseP RNA (in association with an RNA guide sequence) or Neurospora VS RNA motif, for example. Specific examples of hammerhead motifs are described by Rossi et al. Nucleic Acids Res. 1992 Sep. 11 ; 20(17):4559-65. Examples of hairpin motifs are described by Hampel et al. (Eur. Pat. Appl. Publ. No. EP 0360257), Hampel and Tritz, Biochemistry 1989 Jun. 13; 28(12):4929-33; Hampel et al , Nucleic Acids Res. 1990 Jan. 25; 18(2):299-304 and U.S. Pat. No. 5,631,359. An example of the hepatitis virus motif is described by Perrotta and Been, Biochemistry. 1992 Dec. 1 ; 31(47): 11843-52; an example of the RNaseP motif is described by Guerrier-Takada et al, Cell. 1983 December; 35(3 Pt 2):849-57; Neurospora VS RNA ribozyme motif is described by Collins (Saville and Collins, Cell. 1990 May 18; 61(4):685-96; Saville and Collins, Proc Natl Acad Sci USA. 1991 Oct. 1 ; 88(19):8826- 30; Collins and Olive, Biochemistry. 1993 Mar. 23; 32(l l):2795-9); and an example of the Group I intron is described in U.S. Pat. No. 4,987,071. Ribozyme constructs need not be limited to specific motifs mentioned herein.

[0137] Methods of producing a ribozyme targeted to any polynucleotide sequence are known in the art. Ribozymes may be designed as described in Int. Pat. Appl. Publ. No. WO 93/23569 and Int. Pat. Appl. Publ. No. WO 94/02595, and synthesized to be tested in vitro and in vivo, as described therein.

[0138] Ribozyme activity can be optimized by altering the length of the ribozyme binding arms or chemically synthesizing ribozymes with modifications that prevent their degradation by serum ribonucleases (see e.g. , Int. Pat. Appl. Publ. No. WO 92/07065; Int. Pat. Appl. Publ. No. WO 93/15187; Int. Pat. Appl. Publ. No. WO 91/03162; Eur. Pat. Appl. Publ. No. 92110298.4; U.S. Pat. No. 5,334,711 ; and Int. Pat. Appl. Publ. No. WO 94/13688, which describe various chemical modifications that can be made to the sugar moieties of enzymatic RNA molecules),

modifications which enhance their efficacy in cells, and removal of stem II bases to shorten RNA synthesis times and reduce chemical requirements. Supermir

[0139] A supermir refers to a single stranded, double stranded or partially double stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or both or modifications thereof, which has a nucleotide sequence that is substantially identical to an miRNA and that is antisense with respect to its target. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages and which contain at least one non-naturally-occurring portion which functions similarly. Such modified or substituted oligonucleotides are preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. In a preferred

embodiment, the supermir does not include a sense strand, and in another preferred embodiment, the supermir does not self-hybridize to a significant extent. A supermir can have secondary structure, but it is substantially single-stranded under physiological conditions. A supermir that is substantially single- stranded is single-stranded to the extent that less than about 50% (e.g., less than about 40%, 30%, 20%, 10%, or 5%) of the supermir is duplexed with itself. The supermir can include a hairpin segment, e.g., sequence, preferably at the 3' end can self hybridize and form a duplex region, e.g., a duplex region of at least 1, 2, 3, or 4 and preferably less than 8, 7, 6, or n nucleotides, e.g., 5 nucleotides. The duplexed region can be connected by a linker, e.g., a nucleotide linker, e.g., 3, 4, 5, or 6 dTs, e.g., modified dTs. The supermir is duplexed with a shorter oligo, e.g., of 5, 6, 7, 8, 9, or 10 nucleotides in length, e.g., at one or both of the 3' and 5' end or at one end and in the non-terminal or middle of the supermir. miRNA Mimics

[0140] miRNA mimics represent a class of molecules that can be used to imitate the gene silencing ability of one or more miRNAs. In the embodiments of the present invention, miRNA mimics are immuno stimulatory agents. Thus, the term "microRNA mimic" refers to synthetic non-coding RNAs (i.e. the miRNA is not obtained by purification from a source of the endogenous miRNA) that are capable of entering the RNAi pathway and regulating gene expression through inhibiting targeted mRNA. miRNA mimics can be designed as mature molecules (e.g. single stranded) or mimic precursors (e.g., pri- or pre-miRNAs) miRNA mimics can be comprised of nucleic acid (modified or modified nucleic acids) including oligonucleotides comprising, without limitation, RNA, modified RNA, DNA, modified DNA, locked nucleic acids, or 2'-0,4'-C-ethylene-bridged nucleic acids (ENA), or any combination of the above (including DNA-RNA hybrids). In addition, miRNA mimics can comprise conjugates that can affect delivery, intracellular compartmentalization, stability, specificity, functionality, strand usage, and/or potency. In one design, miRNA mimics are double stranded molecules (e.g. , with a duplex region of between about 16 and about 31 nucleotides in length) and contain one or more sequences that have identity with the mature strand of a given miRNA. Modifications can comprise 2' modifications (including 2'-0 methyl modifications and 2' F modifications) on one or both strands of the molecule and internucleotide modifications (e.g. phorphorthioate modifications) that enhance nucleic acid stability and/or specificity. In addition, miRNA mimics can include overhangs. The overhangs can consist of 1-6 nucleotides on either the 3' or 5' end of either strand and can be modified to enhance stability or functionality. In one embodiment, a miRNA mimic comprises a duplex region of between 16 and 31 nucleotides and one or more of the following chemical modification patterns: the sense strand contains 2'-0-methyl

modifications of nucleotides 1 and 2 (counting from the 5' end of the sense oligonucleotide), and all of the Cs and Us; the antisense strand modifications can comprise 2' F modification of all of the Cs and Us, phosphorylation of the 5' end of the oligonucleotide, and stabilized

internucleotide linkages associated with a 2 nucleotide 3' overhang.

Antimir or miRNA Inhibitor.

[0141] The terms "antimir" "microRNA inhibitor", "miR inhibitor", or "inhibitor" are synonymous and refer to oligonucleotides or modified oligonucleotides that interfere with the ability of specific miRNAs to block targeted mRNA translation. In general, the inhibitors are nucleic acids or modified nucleic acids in nature including oligonucleotides comprising RNA, modified RNA, DNA, modified DNA, locked nucleic acids (LNAs), or any combination of the above. Modifications include 2' modifications (including 2'-0 alkyl modifications and 2' F modifications) and internucleotide modifications (e.g. phosphorothioate modifications) that can affect delivery, stability, specificity, intracellular compartmentalization, or potency. miRNA inhibitors can comprise conjugates that can affect delivery, intracellular compartmentalization, stability, and/or potency. Inhibitors can adopt a variety of configurations including single stranded, double stranded (RNA/RNA or RNA/DNA duplexes), and hairpin designs. In general, microRNA inhibitors comprise contain one or more sequences or portions of sequences that are complementary or partially complementary with the mature strand (or strands) of the miRNA to be targeted. miRNA inhibitors may also comprise additional sequences located 5' and 3' to the sequence that is the reverse complement of the mature miRNA. The additional sequences may be the reverse complements of the sequences that are adjacent to the mature miRNA in the pri- miRNA from which the mature miRNA is derived, or the additional sequences may be arbitrary sequences (having a mixture of A, G, C, or U). In some embodiments, one or both of the additional sequences are arbitrary sequences capable of forming hairpins. Thus, in some embodiments, the sequence that is the reverse complement of the miRNA is flanked on the 5' side and on the 3' side by hairpin structures. Micro-RNA inhibitors, when double stranded, may include mismatches between nucleotides on opposite strands. Furthermore, micro-RNA inhibitors may be linked to conjugate moieties in order to facilitate uptake of the inhibitor into a cell. For example, a micro-RNA inhibitor may be linked to cholesteryl 5-(bis (4- methoxyphenyl)(phenyl)methoxy)-3 hydroxypentylcarbamate) which allows passive uptake of a micro-RNA inhibitor into a cell. Micro-RNA inhibitors, including hairpin miRNA inhibitors, are described in detail in Vermeulen et ah, "Double-Stranded Regions Are Essential Design

Components Of Potent Inhibitors of RISC Function," RNA 13: 723-730 (2007) and in

WO2007/095387 and WO 2008/036825. A person of ordinary skill in the art can select a sequence from the database for a desired miRNA and design an inhibitor useful for the methods disclosed herein.

Oligonucleotide Modifications

[0142] Unmodified oligonucleotides may be less than optimal in some applications, e.g., unmodified oligonucleotides can be prone to degradation by e.g., cellular nucleases. Nucleases can hydrolyze nucleic acid phosphodiester bonds. However, chemical modifications of oligonucleotides can confer improved properties, and, e.g., can render oligonucleotides more stable to nucleases.

[0143] As oligonucleotides are polymers of subunits or monomers, many of the modifications described below occur at a position which is repeated within an oligonucleotide, e.g., a modification of a base, a sugar, a phosphate moiety, or the non-bridging oxygen of a phosphate moiety. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at a single nucleoside within an oligonucleotide.

[0144] In some cases the modification will occur at all of the subject positions in the

oligonucleotide but in many, and in fact in most cases it will not. By way of example, a modification may only occur at a 3' or 5' terminal position, may only occur in the internal region, may only occur in a terminal region, e.g. at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of an oligonucleotide. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a double-stranded oligonucleotide or may only occur in a single strand region of a double-stranded oligonucleotide. E.g., a phosphorothioate modification at a non-bridging oxygen position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5' end or ends can be phosphorylated.

[0145] A modification described herein may be the sole modification, or the sole type of modification included on multiple nucleotides, or a modification can be combined with one or more other modifications described herein. The modifications described herein can also be combined onto an oligonucleotide, .e.g. different nucleotides of an oligonucleotide have different modifications described herein.

[0146] In some embodiments it is particularly preferred, e.g., to enhance stability, to include particular nucleobases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5' or 3' overhang, or in both. E.g., it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3' or 5' overhang will be modified, .e.g., with a modification described herein. Modifications can include, .e.g., the use of modifications at the 2' OH group of the ribose sugar, .e.g., the use of deoxyribonucleotides, .e.g., deoxythymidine, instead of ribonucleotides, and modifications in the phosphate group, e.g., phosphothioate modifications. Overhangs need not be homologous with the target sequence.

The Phosphate Group

[0147] The phosphate group is a negatively charged species. The charge is distributed equally over the two non-bridging oxygen atoms. However, the phosphate group can be modified by replacing one of the oxygens with a different substituent. One result of this modification to RNA phosphate backbones can be increased resistance of the oligoribonucleotide to nucleolytic breakdown. Thus while not wishing to be bound by theory, it can be desirable in some embodiments to introduce alterations which result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.

[0148] Examples of modified phosphate groups include phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters. In certain embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced by any of the following: S, Se, BR₃ (R is hydrogen, alkyl, aryl), C (i.e. an alkyl group, an aryl group, etc. . . . ), H, NR₂ (R is hydrogen, alkyl, aryl), or OR(R is alkyl or aryl). The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms renders the phosphorous atom chiral; in other words a phosphorous atom in a phosphate group modified in this way is a stereogenic center. The stereogenic phosphorous atom can possess either the "R" configuration (herein Rp) or the "S " configuration (herein Sp).

[0149] Phosphorodithioates have both non-bridging oxygens replaced by sulfur. The phosphorus center in the phosphorodithioates is achiral which precludes the formation of

oligoribonucleotides diastereomers. Thus, while not wishing to be bound by theory,

modifications to both non-bridging oxygens, which eliminate the chiral center, .e.g.

phosphorodithioate formation, may be desirable in that they cannot produce diastereomer mixtures. Thus, the non-bridging oxygens can be independently any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl). [0150] The phosphate linker can also be modified by replacement of bridging oxygen, (i.e. oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at the either linking oxygen or at both the linking oxygens. When the bridging oxygen is the 3'-oxygen of a nucleoside, replacement with carbon is preferred. When the bridging oxygen is the 5'-oxygen of a nucleoside, replacement with nitrogen is preferred.

Replacement of the Phosphate Group

[0151] The phosphate group can be replaced by non-phosphorus containing connectors. While not wishing to be bound by theory, it is believed that since the charged phosphodiester group is the reaction center in nucleolytic degradation, its replacement with neutral structural mimics should impart enhanced nuclease stability. Again, while not wishing to be bound by theory, it can be desirable, in some embodiment, to introduce alterations in which the charged phosphate group is replaced by a neutral moiety.

[0152] Examples of moieties which can replace the phosphate group include methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime,

methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino. Preferred replacements include the methylenecarbonylamino and methylenemethylimino groups.

[0153] Modified phosphate linkages where at least one of the oxygens linked to the phosphate has been replaced or the phosphate group has been replaced by a non-phosphorous group, are also referred to as "non phosphodiester backbone linkage."

Replacement of Ribophosphate Backbone

[0154] Oligonucleotide-mimicking scaffolds can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. While not wishing to be bound by theory, it is believed that the absence of a repetitively charged backbone diminishes binding to proteins that recognize polyanions (.e.g. nucleases). Again, while not wishing to be bound by theory, it can be desirable in some embodiment, to introduce alterations in which the bases are tethered by a neutral surrogate backbone. Examples include the mophilino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates. A preferred surrogate is a PNA surrogate.

Sugar Modifications

[0155] A modified RNA can include modification of all or some of the sugar groups of the ribonucleic acid. E.g. , the 2' hydroxyl group (OH) can be modified or replaced with a number of different "oxy" or "deoxy" substituents. While not being bound by theory, enhanced stability is expected since the hydroxyl can no longer be deprotonated to form a 2'-alkoxide ion. The 2'- alkoxide can catalyze degradation by intramolecular nucleophilic attack on the linker phosphorus atom. Again, while not wishing to be bound by theory, it can be desirable to some embodiments to introduce alterations in which alkoxide formation at the 2' position is not possible.

[0156] Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (OR, .e.g. , R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycols (PEG), [AGAIN SHOULD THESE BE SUBSCRIPTS?] 0(CH₂CH₂0) _nCH₂CH₂OR; "locked" nucleic acids (LNA) in which the 2' hydroxyl is connected, e.g., by a methylene bridge, to the 4' carbon of the same ribose sugar; O-AMINE (AMINE=NH₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino, ethylene diamine, polyamino) and aminoalkoxy, 0(CH₂) _n AMINE, (e.g. , AMINE=NH₂; alkylamino, dialkylamino,

heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino, ethylene diamine, polyamino). It is noteworthy that oligonucleotides containing only the methoxyethyl group (MOE), (OCH₂CH₂OCH₃, a PEG derivative), exhibit nuclease stabilities comparable to those modified with the robust phosphorothioate modification.

[0157] "Deoxy" modifications include hydrogen (i.e. deoxyribose sugars, which are of particular relevance to the overhang portions of partially ds RNA); halo (e.g. , fhioro); amino (e.g. NH₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid); NH(CH₂CH₂NKCH₂CH₂- AMINE (AMINE=NH₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino),— NHC(0)R(R=alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio- alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g. , an amino functionality. Preferred substituents are 2'-methoxyethyl, 2'- OCH3, 2'-0-allyl, 2'-C-allyl, and 2'-fluoro.

[0158] The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, an oligonucleotide can include nucleotides containing e.g. , arabinose, as the sugar. The monomer can have an alpha linkage at the Γ position on the sugar, e.g. , alpha-nucleo sides.

Oligonucleotides can also include "abasic" sugars, which lack a nucleobase at C-Γ. These abasic sugars can also be further containing modifications at one or more of the constituent sugar atoms. Oligonucleotides can also contain one or more sugars that are in the L form, e.g. L-nucleosides.

Terminal Modifications

[0159] The 3' and 5' ends of an oligonucleotide can be modified. Such modifications can be at the 3' end, 5' end or both ends of the molecule. They can include modification or replacement of an entire terminal phosphate or of one or more of the atoms of the phosphate group. E.g. , the 3' and 5' ends of an oligonucleotide can be conjugated to other functional molecular entities such as labeling moieties, e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protecting groups (based e.g. , on sulfur, silicon, boron or ester). The functional molecular entities can be attached to the sugar through a phosphate group and/or a linker. The terminal atom of the linker can connect to or replace the linking atom of the phosphate group or the C-3' or C-5' 0, N, S or C group of the sugar. Alternatively, the linker can connect to or replace the terminal atom of a nucleotide surrogate (e.g. , PNAs).

[0160] When a linker/phosphate-functional molecular entity-linker/phosphate array is interposed between two strands of a dsRNA, this array can substitute for a hairpin RNA loop in a hairpin- type RNA agent.

[0161] Terminal modifications useful for modulating activity include modification of the 5' end with phosphate or phosphate analogs. E.g. , in preferred embodiments antisense strands of dsRNAs, are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus 5'- phosphate modifications include those which are compatible with RISC mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO)2(0)P— 0-5'); 5'-diphosphate

((HO)2(0)P-0-P(HO)(0)-0-5'); 5'-triphosphate ((HO)2(0)P-0-(HO)(0)P-0-P(HO)(0)- 0-5'); 5'-guanosine cap (7-methylated or non-methylated) (7m-G-0-5'-(HO)(0)P-0-(HO)(0)P- -O— P(HO)(0)— 0-5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-0-5'-(HO)(0)P-0-(HO)(0)P-0-P(HO)(0)-0-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P— 0-5'); 5'-monodithiophosphate (phosphorodithioate;

(HO)(HS)(S)P-0-5'), 5'-phosphorothiolate ((HO)2(0)P-S-5'); any additional combination of oxygen/sulfur replaced monophosphate, diphosphate and triphosphates (e.g. 5'-alpha- thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(0)P— NH-5', (ΗΟ)(ΝΗ2)(0)Ρ-0-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g. RP(OH)(0)-0-5'-, (OH)2(0)P-5'-CH2-), 5'-alkyletherphosphonates

(R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(0)-0-5'-).

[0162] Terminal modifications can also be useful for monitoring distribution, and in such cases the preferred groups to be added include fluorophores, e.g. , fluorscein or an Alexa dye, e.g., Alexa 488. Terminal modifications can also be useful for enhancing uptake, useful modifications for this include cholesterol. Terminal modifications can also be useful for cross-linking an RNA agent to another moiety; modifications useful for this include mitomycin C.

Nucleobases

[0163] Adenine, guanine, cytosine and uracil are the most common bases found in RNA. These bases can be modified or replaced to provide RNA's having improved properties. E.g. , nuclease resistant oligoribonucleotides can be prepared with these bases or with synthetic and natural nucleobases (e.g., inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine) and any one of the above modifications. Alternatively, substituted or modified analogs of any of the above bases, e.g., "unusual bases", "modified bases", "non-natural bases" and "universal bases" described herein, can be employed. Examples include without limitation 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkyl cytosine,7-deazaadenine, N6, N6-dimethyladenine, 2,6-diaminopurine, 5-amino-allyl-uracil, N3- methyluracil, substituted 1,2,4-triazoles, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5- methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3-(3-amino-3- carboxypropyl)uracil, 3-methylcytosine, 5-methylcytosine, N.sup.4-acetyl cytosine, 2- thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N-6-isopentenyladenine, N- methyl guanines, or O-alkylated bases. Further purines and pyrimidines include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in the Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, and those disclosed by Englisch et ah, Angewandte Chemie, International Edition, 1991, 30, 613.

Cationic Groups

[0164] Modifications to oligonucleotides can also include attachment of one or more cationic groups to the sugar, base, and/or the phosphorus atom of a phosphate or modified phosphate backbone moiety. A cationic group can be attached to any atom capable of substitution on a natural, unusual or universal base. A preferred position is one that does not interfere with hybridization, i.e., does not interfere with the hydrogen bonding interactions needed for base pairing. A cationic group can be attached e.g., through the C2' position of a sugar or analogous position in a cyclic or acyclic sugar surrogate. Cationic groups can include e.g., protonated amino groups, derived from e.g. , O-AMINE (ΑΜΙΝΕ=ΝΗ₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino, ethylene diamine, polyamino); aminoalkoxy, e.g. , 0(CH₂)_nAMINE, (e.g. , AMINE=NH₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino, ethylene diamine, polyamino); amino (e.g. NH₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid); or

NH(CH₂CH₂NH)_nCH₂CH₂- AMINE (AMINE=NH₂; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino).

Placement within an Oligonucleotide

[0165] Some modifications may preferably be included on an oligonucleotide at a particular location, e.g. , at an internal position of a strand, or on the 5' or 3' end of an oligonucleotide. A preferred location of a modification on an oligonucleotide, may confer preferred properties on the agent. For example, preferred locations of particular modifications may confer optimum gene silencing properties, or increased resistance to endonuclease or exonuclease activity.

[0166] One or more nucleotides of an oligonucleotide may have a 2'-5' linkage. One or more nucleotides of an oligonucleotide may have inverted linkages, e.g. 3'-3', 5'-5',2'-2' or 2'-3' linkages.

[0167] A double- stranded oligonucleotide may include at least one 5'-uridine-adenine-3' (5'-UA- 3') dinucleotide wherein the uridine is a 2'-modified nucleotide, or a terminal 5'-uridine-guanine- 3' (5'-UG-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide, or a terminal 5'- cytidine-adenine-3' (5'-CA-3') dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide, or a terminal 5 '-uridine-uridine- 3' (5'-UU-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide, or a terminal 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide, or a terminal 5'-cytidine-uridine-3' (5'-CU-3') dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide, or a terminal 5'-uridine-cytidine-3' (5'-UC-3')

dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide. Double- stranded oligonucleotides including these modifications are particularly stabilized against endonuclease activity WO 00/44895, WO01/75164, or WO02/44321.

"Protein/peptide variants"

[0168] Also contemplated are polypeptides BCL6, SOCS 1, CXCR4 and DUSP10, and biologically active fragments thereof, that contain minor variations provided that the variations in the amino acid sequence maintain at least 75%, more preferably at least 80%, 90%, 95%, and most preferably 99% sequence identity and the molecule retains bioactivity (e.g., inhibition of T cell proliferation, differentiation of T cells into regulatory T cells, suppression of immune responses mediated by activated T cells). In particular, conservative amino acid replacements are contemplated. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into families: (1) acidic=aspartate, glutamate; (2) basic=lysine, arginine, histidine; (3) non- polar=alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar=glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. More preferred families are: serine and threonine are aliphatic-hydroxy family; asparagine and glutamine are an amide-containing family; alanine, valine, leucine and isoleucine are an aliphatic family; and phenylalanine, tryptophan, and tyrosine are an aromatic family.

[0169] The polypeptides to be administered therapeutically can be recombinant and may be expressed using any suitable vector. Typically, the vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and may optionally include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, and at least one selectable marker. The invention also contemplates expressing the polypeptides using artificial chromosomes, e.g., bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), mammalian artificial chromosomes (MACs), and human artificial chromosomes (HACs), e.g., when it is necessary to propagate nucleic acids larger than can readily be accommodated in viral or plasmid vectors. The polypeptides may be expressed using any suitable vector. Typically, the vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and may optionally include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, and at least one selectable marker. The invention also contemplates expressing the using artificial chromosomes, e.g., bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), mammalian artificial chromosomes (MAs), and human artificial chromosomes (HACs), e.g., when it is necessary to propagate nucleic acids larger than can readily be accommodated in viral or plasmid vectors.

[0170] The polypeptides for therapeutic use may be expressed in any appropriate host cell. The host cell can be prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells). A host cell strain may be chosen for its ability to carry out desired post-translational modifications of the expressed protein. Such post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, hydroxylation, sulfation, lipidation, and acylation.

[0171] Exemplary prokaryotic host cells are E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium cells. Exemplary yeast host cells are Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Pichia methanolica. Exemplary insect host cells are those from Spodoptera frugiperda (e.g., Sf9 and Sf21 cell lines, and

EXPRESSF.TM. cells (Protein Sciences Corp., Meriden, Conn., USA)), Drosophila S2 cells, and Trichoplusia ni HIGH FIVE.RTM. Cells (Invitrogen, Carlsbad, Calif., USA). Exemplary mammalian host cells are COS l and COS7 cells, NSO cells, Chinese hamster ovary (CHO) cells, NIH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, MDCK, HEK293, WI38, murine ES cell lines (e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ), K562, Jurkat cells, BW5147 and any other commercially available human cell lines. Other useful mammalian cell lines are well known and readily available from the American Type Culture Collection (ATCC)

(Manassas, Va., USA) and the National Institute of General Medical Sciences (NIGMS) Human Genetic Cell Repository at the Coriell Cell Repositories (Camden, N.J., USA).

Transplanted organs

[0172] Transplanted organs include, for example, heart, kidney, skin, lung, liver, eye, bone, and bone marrow. Transplanted tissue includes, for example, vascular tissue. Transplanted cells include stem cells, e.g., umbilical cord stem cells or adult stem cells, pancreatic islet cells, epithelial cells, endothelial cells, and liver cells. The transplant may also be a prosthetic device, e.g., stent. The transplant may be xenogeneic or allogeneic. Preferably, the subject is human

[0173] In one embodiment, the active immunosuppressive agent(s) is administered concurrently with a second type of immunosuppressive agent, such as cyclosporine, OKT3 Antibody, rapamycin, Campath I, anti-CD69 antibody, thymoglobulin, and anti-thymocytic antibody. The Active Immunosuppressants may also be administered before or after administration of the second immunosuppressive agent. In another embodiment, the active immunosuppressive agent(s) is administered at the time of transplantation and twice a week for two weeks as is routine for transplants. In another embodiment, the active immunosuppressive agent(s) is administered to the subject at the onset of or during rejection. Symptoms associated with rejection of a transplant are well known in the art and include for kidney, increased blood urea nitrogen (BUN) levels, for pancreas, increased glycemia, for heart, lymphocyte infiltrates, and for liver, increased levels of enzymes such as aspartate aminotransferase (SGOT) and alanine aminotransferase (SGPT).

[0174] The autoimmune disorder treated can be any such disorder, and includes, without limitation, rheumatoid arthritis, Crohn's disease, multiple sclerosis, autoimmune diabetes, systemic lupus erythematosus, lupus vulgaris, thyroiditis, Addison's Disease, hemolytic anemia, antiphospbolipid syndrome, dermatitis, allergic encephalomyelitis, glomerulonephritis,

Goodpasture's Syndrome, Graves' Disease, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, and autoimmune

inflammatory eye disease. Preferably, in the subject method, the subject is human. In one embodiment, the polypeptide is administered to the subject during a flare-up of an autoimmune attack. The method may further comprise administration of additional immunosuppressive drugs, e.g., cytotoxic agents, cyclosporine, methotrexate, azathioprine, and corticosteroids. Allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems, may also be similarly treated. Therapeutic agents can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility. [0175] Autoimmunity is the failure of an organism to recognize its own constituent parts as self, developing an immune response against its own cells and tissues. Treatments for autoimmune disease have traditionally been immunosuppressive, anti-inflammatory (steroids), or palliative. Autoimmune diseases which target a single tissue generally involve antigen-specific CD4 and CD8 effector T cells. There is evidence that autoimmunity develops when regulatory T cells are absent or dysfunctional. Multiple sclerosis, systemic lupus erythematosus, and rheumatoid arthritis are autoimmune-mediated diseases that are responsive to suppression or modulation of the immune system. For patients with severe disease, immunosuppression may be intensified to the point of myelosuppression or hematopoietic ablation. A major goal in treatment of autoimmune diseases is to develop a drug which inhibits the inflammatory process acting specifically on auto-aggressive T cells, or inducing the development of auto-antigen specific regulatory T cells.

[0176] This invention further provides a method for treating a subject afflicted with an inflammatory disorder, comprising administering to the subject a therapeutically effective amount of one or more of the active immunosuppressive agent(s) that block the relevant miRs. The inflammatory disorder treated can be any such disorder, and includes, without limitation, (i) inflammatory diseases such as chronic inflammatory pathologies (including chronic

inflammatory pathologies such as, but not limited to, sarcoidosis, chronic inflammatory bowel disease, ulcerative colitis, and Crohn's pathology); (ii) vascular inflammatory pathologies such as, but not limited to, disseminated intravascular coagulation, atherosclerosis, Kawasaki's pathology and vasculitis syndromes (such as, but not limited to, polyarteritis nodosa, Wegener's granulomatosis, Henoch- Schonlein purpura, giant cell arthritis and microscopic vasculitis of the kidneys); (iii) chronic active hepatitis; (iv) Sjogren's syndrome; (v) spondyloarthropathies such as ankylosing spondylitis, psoriatic arthritis and spondylitis, enteropathic arthritis and spondylitis, reactive arthritis and arthritis associated with inflammatory bowel disease; and (vi) uveitis. Preferably, in the subject method, the subject is human. EXAMPLES Materials and Methods

[0177] 1. All miPv inhibitors or mimics used in the Examples are commercially available from Dharmacon Technology.

[0178] 2. Target sites of miRs on various genes mRNAs were identified using public search websites, such as http://www.microrna.org/microrna/home.do.

[0179] 3. Gene bank number of various miRs are shown as follows:

Homo sapiens miR-21: NR_029493.1

Homo sapiens miR-30b: NR_029666.1

Homo sapiens miR146a: NR_029701.1

Homo sapiens miR155: NR_030784.1 miR mimic and hairpin miR inhibitors

[0180] Stability-enhanced miR-30b RNA oligonucleotide (miRIDIAN Mimic-30b) and miR- 155 oligonucleotide (miRIDIAN Mimic-155), along with hairpin RNA inhibitors (meridian hairpin inhibitor miR-30b, miR-155) and the control non-targeting RNA oligonucleotide (miRIDIAN Mimic Negative Control #1) were purchased from Dharmacon.

Cell cultures

[0181] Preparation of PBMC and negative isolation of CD3⁺ T cells have been previously described.⁹ For ILT3Fc treatment of alio- stimulated CD8⁺ T cells, CD3⁺CD25^" T cells (lxloVl) were cultured with irradiated CD2-depleted PBMC (0.5xl0⁶/ml) in the presence of absence of ILT3Fc (50ug/ml). On day 7, CD8⁺ T cells were negatively selected from these cultures and tested for suppressor activity prior to use in mRNA or microarray assays. [0182] CD8⁺ T cells obtained by negative selection using magnetic beads were incubated in CD3-coated T cell activation plates (BD Biosciences) in the presence of 2 μg/ml anti-CD28 antibodies. On day 2, cells were collected, washed twice and transfected with either reporter constructs or RNA oligomers (miR mimics or hairpin inhibitors) using the nucleofectin method. CD8⁺ T cells transfected with single hairpin inhibitors of miR or with mixtures of two inhibitors (50x10³ per well) were added at a 1: 1 ratio to autologous, unprimed CD4⁺ CD25^" T cells, in cultures containing anti-CD3 mAb (UCHTl clone from BD Bioscience at ^g/ml) and autologous APC (50x10 per well). Cultures were labeled with tritiated thymidine after 72 hours and harvested 18 hours later.

Gene promoter and 3'UTR constructs

[0183] Sequences corresponding to -1296 - +40 from the RNA start of BCL6 and to - 748 - +52 from the RNA start of SOCS-1 genes were cloned from genomic DNA by PCR using high fidelity Taq and gene specific primers (supplementary file). These gene promoters, previously shown to be functional in response to various stimuli in reporter assays¹⁶, were subsequently cloned into Hindlll or Bgl II and Nhel sites of pGL3 basic Firefly-luciferase construct (Promega). Mir-21 promoter reporter construct (0.6 kb) was similarly constructed. Wild type miR- 146a promoter construct and its NF-kB binding site mutant originally provided by D.

Baltimore were obtained from Addgene Inc. 17 Mir-155 promoter construct and its AP-1 and NF- kB binding site mutants were kindly provided by Dr. Erik Flemmington. 18

[0184] 3'UTR of various genes (BCL6, 1.1 kb; SOCS 1, 0.4 kb; DUSP10, 1.0 kb) were obtained from polyA primed- CD8⁺ T cell cDNA libraries by PCR reactions using a high fidelity Taq DNA polymerase (Invitrogen) and gene specific primers. PCR products were first cloned into pGEM-T^® Easy vector (Promega), excised from recombinant plasmids by Not I digestion and subcloned into psiCHECK™-2 luciferase reporter (Promega). All reporter constructs were completely sequenced from both ends.

Mutagenesis

[0185] Site directed mutagenesis of AP-1 binding sites in miR-21 promoter constructs and mutagenesis of miR-30b and miR- 155 binding sites in 3'UTR of BCL6 and SOCS 1 was performed using QuickChangell® (Stratagene) with mutated gene specific primers and corresponding DNA templates.

Transfections of reporter constructs and miR oligos

[0186] Sorted CD8⁺ T cells were stimulated with CD3/CD28 in BD Bioscience plates. After 48 h 3-5x10⁶ cells were collected and co-transfected with 3ug promoter constructs (either BCL6 or SOCS 1) and 2μg pGL4.70RLU (ReniUa luciferase) DNA using Amaxa's Human T cell Nucleofector Kit (Lonza). Sixteen hours after transfection, cells were lysed and assayed for both Firefly and Renilla luciferase activities in a single tube luminometer (Turner BioSystems 20/20). Normalized promoter activity was measured as units of Firefly luciferase activities divided by units of Renilla luciferase. Transfection of 3'UTR reporter gene activity was similarly performed. Normalized 3'UTR Renilla luciferase activity was normalized with internal Firefly luciferase activity which was co-expressed in the same cells.

[0187] For promoter reporter assays, Jurkat T cells were pre-treated with either human IgG or ILT3Fc for 16 hours, then stimulated for 48 hours with mAb anti CD3 and CD28. Cells were co-transfected with 0^g of various pGL3 plasmids and 0.4 μg of pGL4-7.0 of Renilla luciferase plasmid using lipofectamine 2000 (Invitrogen). Reporter gene assays were performed 36 hours later.

MicroRNA array and real time PCR

[0188] Allospecific CD8⁺ T suppressor cells, generated as described⁹'¹¹, were analyzed as follows. Five microgram of total RNA prepared from these cells using Trizol® (Invitrogen), were annealed to oligonucleotide primer mix and hybridized to 132 miR oligonucleotide probes. Streptavidin-HRP chemiluminescence was used for detection of micro RNA expression (Signosis). Real-time PCR detection of microRNA was performed using TaqMan® Small RNA assays (Applied Biosystems).

Nuclear protein extraction and Immunoblotting [0189] Total cell lysates (2C^g) prepared from CD8⁺ T lymphocytes or Jurkat T cells were transferred to a PVDF membrane and probed with various antibodies as described. In some experiments, a commercial protein extract kit (NucBuster, Novagen) was used to extract nuclear proteins. For signaling studies, Jurkat cells were stimulated with CD3/CD28 mAbs (2 μg/ml) and antimouse IgG were incubated for the indicated time with or without ILT3Fc (15 μg/ml).

MicroRNA target prediction

[0190] Several web-accessible microRNA data base searching programs were used for prediction of microRNA target sites. These include http://www.microrna.org, http://www.miRBase.org, and http://www.targetscan.org.

Statistical Analysis

[0191] Differences between control and experimental groups (each consisting of a minimum of 3 individual experiments) were estimated using the T test for paired 2-tailed distribution. Mean and standard error was calculated for each group. Differences smaller than 0.05 were considered significant.

EXAMPLE I

ILT3 inhibits the expression of proinflammatory miRs expression in allo-antigen stimulated T cells

[0192] We first explored the miR transcriptional profiles of CD8⁺ T suppressor cells generated in 7-day MLC containing ILT3Fc and in control CD8⁺ T cells alio stimulated without ILT3Fc. A group of at least 6 miRs (miR-21, miR-146a, miR-30b, miR-30c, miR-29 and miR-155), which are expressed at negligible levels in unstimulated CD8⁺ T cells, were consistently upregulated by allo-stimulation in three independent experiments (Figure 1A). When ILT3Fc was added to the cultures, the level of expression of these genes was strongly downregulated, as confirmed by real-time PCR analysis (Figure IB). Similarly, membrane ILT3 also inhibits the expression of miR-21, -30b, -146a, and -155 as demonstrated in experiments in which T cells were alio stimulated with DC transfected with ILT3 siRNA (ILT3KD-DC) or empty vector (control- DC). Upon priming with ILT3KD DC, CD8⁺ T cells, sorted after 16 hours from these cultures, showed much higher expression of miR-21, miR-30b, miR-146a, and miR-155, as determined by RT-PCR, compared to CD8⁺ T cells stimulated with ILT3⁺ control DC (Figure 1C). Hence, both membrane and soluble ILT3 inhibit miRs expressed by MLC- stimulated CD8⁺ T cells.

EXAMPLE II

Induction of BCL6, SOCS1 and DUSP10 by ILT3Fc is 3'UTR dependent

[0193] Computer aid searches for putative targets of these miRs showed that many of them were mRNAs encoded by genes whose expression was upregulated (>3.0 fold) in CD8⁺ T cells alio stimulated in the presence of ILT3Fc compared to CD8 T cells primed in cultures without

ILT3Fc. 11 ' 12 Table I shows a partial list of these ILT3Fc-upregulated genes encoding mRNAs whose 3'UTRs contain target sites for ILT3Fc modulated miRs. Genes induced by ILT3.Fc treatment that encode mRNAs that are predicted targets of miR-21 include dual specific phosphatases (DUSP) DUSP8 and DUSP10, known to be inhibitors of the MAP kinase pathway and cytokine production (reviewed by 19). Also included in this group are TGFBR2 and TOB1; involved in regulation of T cell responses. 20 ' 21 Genes upregulated by ILT3Fc that encode mRNAs that are predicted targets of miR-30b and miR-146a are BCL6 and CXCR4,

respectively. There is already evidence that miR-146a controls expression of CXCR4 22 , miR-21 controls TGFBR2 23 ' 24 and miR-155 acts on SOCS1, a negative regulator of cytokine signaling through STAT1.²⁵' ²⁶ SOCS 1 may also be targeted by miR-30b. The experiments described herein show for the first time that miR-21 that targets DUSP 10 mRNA.

[0194] The upregulation of these target genes by ILT3Fc was further confirmed by real-time PCR analysis using 3 independent sample sets. ILT3Fc-induced inhibition of IFN-gamma expression is shown as a control (Figure 2A).

[0195] The upregulated expression of BCL6, SOCS 1 and DUSP10 is integral to the signature of ILT3Fc-induced CD8⁺ Ts. Because these genes are known inhibitors of cytokine production and TCR signaling and are targeted by miRs which are suppressed by ILT3Fc, the relationship between miRs and gene expression was studied in the presence and absence of ILT3Fc. [0196] Since target sites of miRs, with very few exceptions, are located in the 3'UTR of mRNAs, 3'UTR reporter assays were performed. The full length of 3'UTR from BCL6, SOCS l and DUSPIO was cloned and inserted them in psiCheck2 Renilla luciferase constructs. CD8⁺ T cells which had been stimulated with CD3/CD28 mAbs for 48 h in the presence of absence of ILT3Fc were transfected with 3'UTR reporters for an additional 16 hours. ILT3Fc induced an increased luciferase reporter activity in cells transfected with either BCL6, SOCS l or DUSPIO 3'UTR reporters (Figure 2B), showing the importance of the 3'UTR for the ILT3-induced upregulation of these mRNAs. Promoter reporter assays performed on the same genes showed that ILT3Fc had no apparent effect on luciferase activity (supplementary Figure 1).

EXAMPLE III miR-30b, miR-155 and miR-21 target the 3'UTR of ILT3Fc-inducible genes

[0197] The dependence of ILT3Fc-induced upregulation of DUSPIO, SOCS l and BCL6 on the 3'UTR in their respective mRNAs suggested that the miR which target them may play a role in regulation of gene expression. We analyzed BCL6, SOCS l and DUSPIO expression in CD8⁺ T cells by transient transfection of either gene-specific, chemically- stabilized, double-stranded RNA oligomers, that mimic the function of endogenous mature miR (miR mimic), or chemically-modified, single- stranded antisense oligomers that inhibit miR function (miR hairpin inhibitor). Transfection efficiency of either unstimulated or polyclonally stimulated CD8⁺ T cells, monitored by FACS analysis of transfected GFP RNA oligomer, was around 75%. The predicted miR target sites in the 3' UTRs of BCL6, SOCS l and DUSPIO are shown in figure 3A.

[0198] Un-primed CD8⁺ T cells were transfected with miR mimics specific for miR-30b and miR-155. As a control, the cells were transfected with non-targeting RNA oligomers. Western blot analyses of BCL6 and SOCS l proteins, using β-actin as an internal control, showed that over-expression of miR-30b downregulated the expression of BCL6 and SOCS l, whereas overexpression of miR-155 lead to down regulation SOCS l (Figure 3B) but not BCL6 (which has no target site for it). Inhibition of BCL6 and SOCS l mRNA translation by these miR mimics increased with the amount added to the culture. [0199] As a corollary, transfection of the polyclonally stimulated CD8⁺ T cells with gene- specific hairpin inhibitors to knock down the respective miRs induced the upregulation of the target genes (Figure 3C). Hairpin inhibitors of miR-30b induced upregulation of BCL6 and SOCS 1, while inhibitors of miR-155 upregulated only SOCS 1. KD of miR-21 resulted in upregulation of DUSP-10, yet had no effect on BCL6, which lacks the target sequence for miR-21 (Figure 3C).

[0200] To determine whether physical binding of miR to their target sites in 3 'UTR of the corresponding genes mRNAs is required for their downregulation, we generated a series of reporters in which the consensus regions of miR-21, miR-30b or miR-155 sites were mutated. Experiments in which these mutant reporters were transfected in stimulated CD8⁺ T cells showed that mutations of miR-30b sites in 3'UTR of BCL6 and SOCS 1 and mutation of miR-21 site in 3'UTR of DUSP10 abrogated their responsiveness to miR suppression, inducing higher reporter activities than wild-type miR binding sequences (Figure 3D). Mutation of miR-155 in 3'UTR of SOCS 1, as expected, also expressed higher reporter gene activities.

[0201] Taken together, these data indicate that BCL6, SOCS 1 and DUSP10 are direct targets of post-transcriptional regulation mediated by miR-30b, miR-155, and miR-21, respectively. Hence, downregulation of these miRs by ILT3Fc in primed CD8⁺ T cells leads to upregulation of ILT3Fc-inducible gene expression by preventing the miRs from inhibiting translation of the mRNA-encoded proteins.

CD8 T cells transfected with micro RNA inhibitors suppress CD4 T cell responses

[0202] We sought to determine whether ILT3Fc induced generation of T suppressor cells is due to inhibition of these inflammatory miR. For this, CD8⁺ T cells were activated by 2 day incubation with anti-CD3 and CD28 mAb, and then transfected with individual or combinations of miR inhibitors. Sixteen hours after transfection, these CD8⁺ cells were added to autologous CD4⁺ T cells in cultures containing 1 μg/ml of anti-CD3 antibodies and autologous APC. Cell proliferation assay (Figure 4) showed that when CD8⁺ T cells transfected with individual hairpin inhibitors of miR-21, -30b and -155 were added to CD4 T cells, there was no inhibition in T cell proliferation compared to control cultures containing non-targeted oligos. [0203] However, when CD8 T cells transfected with mixtures of miR-21 and -30b or of miR-21 and miR-155 or miR-21, -30b, -155 were added to the cultures, 50 to 80% inhibition of CD3- triggered proliferation was seen in four repeat experiments. ILT3Fc added to CD3-activated CD4 T cells inhibited proliferation by >80%. This suggests that miRs targeting DUSPIO, BCL6 and SOCS 1 act in concert, playing a role in the differentiation of CD8⁺ T suppressor cells (Figure 4).

EXAMPLE IV

ILT3Fc regulates microRNA gene expression by inhibiting their promoter activities

[0204] ILT3Fc thus induced the upregulation of BCL6, DUSPIO and SOCS 1 via downregulation of miRs which target their respective 3'UTR in their mRNA.

[0205] To determine whether miR gene promoters can be activated by anti-CD3/CD28 mAbs MONOCLONALS in Jurkat cells, Firefly lucif erase reporter gene plasmids (pGL3 based), in which the reporter was under the transcriptional control of either miR-21, miR-146a or miR-155 gene promoters, were co-transfected with a Renilla luciferase control reporter construct. The Jurkat T cell line shows high binding of fluorescinated ILT3Fc and its miR expression profile is similar to that of activated human T lymphocytes.

[0206] After 48 hours of incubation with CD3/CD28 mAbs, normalized promoter activities (Firefly luciferase/Renilla luciferase) showed a 2-3.5 fold increase above the level seen in nonstimulated Jurkat cells (Figure 5A). Mutations at the AP-1 binding sites, in the miR-21 or miR-155 gene promoters, completely abolished reporter gene activity. Similarly, mutations at two NF- B binding sites within the promoter region (600 bp from the RNA start) of miR- 146a also greatly diminished reporter gene activities consistent with other reports.²⁶ This indicated that the transcriptional activities of miR-21, miR-146a and miR-155 depend of AP-1 and NF-KB.

[0207] The promoter activities of miR-21, miR-146a and miR-155 genes in CD3/CD28 triggered Jurkat cells pre-treated with various doses (0-50 μg/ml) of ILT3Fc or control human IgG were studied. The results indicated that while human IgG has no effect, ILT3Fc at 5-15 μg/ml strongly (2-4 fold) inhibited miR-21, miR-146a and miR-155 miR gene promoter activities (Figure 5B). Hence, the API or NF-κΒ binding sites within the promoter miR-21, -146a or -155 were crucial to the inhibitory effect of ILT3Fc.

A. Primers were used generation of reporter constructs [0208] 3 'UTR reporter constructs

BCL6: forward 5 ' -TGAAGCATGGAGTGTTGATGC-3 ' (SEQ ID NO: 1) and reverse 5 ' -GCGGTAATGCAGTTTAGAC AC A-3 ' . (SEQ ID NO: 2)

SOCS 1 : forward 5 ' -GAGCTCTTCCCCTTCCAGATT (SEQ ID NO: 3) and reverse 5 ' - AAA ATATAAAATAGGATTCTGCAC AGC-3 ' (SEQ ID NO: 4)

DUSP10: Forward 5 ' - ATGCTCGAGTGACAATGGTCTGGATGGAA-3 ' (SEQ ID NO: 5) and reverse 5 ' -CAC AATC AACAGAA ACAC ACC AAGA-3 ' (SEQ ID NO:6)

[0209] Promoter constructs: (underlines denote restriction site added for cloning into pGL3)

Mir-21: Forward: 5 ' -GCAGCTAGCTTTTCTAAGTTGCCCCAAGC-3 ' (SEQ ID NO: 7) and reverse: 5 ' -GCA AAGCTTTCCTCAGAGTAAGGTCAGCTC-3 ' (SEQ ID NO: 8)

BCL6: Forward: 5 ' -TTTGCTAGCGTCGCTTGAAGGACTCTC AT AGC-3 ' (SEQ ID NO: 9) and reverse: 5 ' -TCCAGATCTGCTAAATGCACAAAAGGGAGCG-3 ' (SEQ ID NO: 10)

SOCS 1: Forward: 5 ' -CGATGCTAGC AGTTTCTTCCGC AGCCGGGTAG (SEQ ID NO: 11) and reverse: 5 ' - ACGT A AGCTTGCGC ATGCTCCGGGGCC AGG- 3 ' (SEQ ID NO: 12)

B. Mutagenesis (underlines denote position of mutant sequences) [0210] AP-1 sites in the Mir-21 promoter

Site 1: Forward:5'- C ATTCTTTTTGG AT A AGG ATA AC ACCC AG ATTGTCC- 3 ' (SEQ ID NO: 13) and

Reverse: 5 ' -GTCCTTATTAGGAC AATCTGGGTGTTATCCTTATCC-3 ' (SEQ ID NO: 14)

Site 2: Forward: 5 ' -TAGGGATGAC ACAAGC ATAAACCCTTTCCTTATTAATTG-3 ' (SEQ ID NO: 15) And reverse: 5 ' -GGTTTGAACCAATTAATAAGGAAAGGGTTTATGCTTG-3 ' (SEQ ID NO: 16)

[0211] MirSOb recognition site in BCL6's 3 'UTR

5 ' -GTATTTTTTTGCAAGTGAAGGCCCACAATTTACAAAGTG-3 ' (SEQ ID NO: 17) and 5 ' -TTTTAATACACACTTTGTAAATTGTGGGCCTTCACTTGC-3 ' (SEQ ID NO: 18)

[0212] Mir-30b recognition site in SOCS1 's 3 'UTR

Forward 5 ' -TCGC ACCTCCTACCTCTTCATGGGGAC ATATACCCAG-3 ' (SEQ ID NO: 19) and

Reverse: 5 ' -GTGCAAAGATACTGGGTATATGTCCCCATGAAGAGG-3 ' (SEQ ID NO: 20) [0213] Mir-155 recognition site in SOCS1 's 3 'UTR

Forward: 5 ' GC AGCGCCCGCCGTGCACGCAGCGGGAACTGGG ATGCCG-3 ' (SEQ ID NO: 21) and Reverse:5-CAAAATAACACGGCATCCCAGTTCCCGCTGCGTGCACG-3' (SEQ ID NO: 22)

Example V

Patient population:

[0214] Plasma or serum was collected from 12 heart allograft recipients (mean age of 55 years old; range, 38-65, included 10 male and 2 female) were selected for this study. Table 1 shows their Demographic, % up-regulation of MIR-21 in serum and biopsy grade. MicroRNA: 1.

Protocol: Isolation of microRNA from plasma or sera:

[0215] (a) Total RNA, including microRNA from plasma or sera was isolated by using the miRNeasy kit (Qiagen). First, spin down 200 μΐ sera/plasma in a micro-centrifuge tube for 10 min at the highest speed at 4°C. Transfer to a clean tube containing 700 μΐ of Qiazol reagent, mix by vertex 5-6 times.

[0216] (b) Spike with 10 μΐ diluted (1: 1000) miR-39 from C. elegans (undiluted micorRNA is 5 n mole/ lml H₂0).

[0217] (c) Add 140 μΐ of chloroform, mix vigorously for 15 sec. centrifuge at the highest speed at 4C for 15 min.

[0218] (d) Transfer the aqueous phase (500 μΐ) to a new tube; add 750 μΐ of 100% ethanol.

[0219] (e) Load onto a RNA column provided by the Qiagen kit, followed the protocol by washing with the buffers provided.

[0220] (f) After spin drying the column, elute RNA by adding 35 ul RNase free water provided in the kit, sitting on a 42-65°C dry bath for 1 min. Spin down at 10,000 RPM at room temp.

Preparation of microRNA cDNA:

[0221] We used the same reagents for standard first stranded cDNA synthesis kit (Invitrogen superscript III first strand cDNA synthesis kit) except that No random primers or oligodT were used. Instead, gene specific primers, provided by Applied Biosystems, are used for synthesis of microRNA cDNA.

[0222] (a) Aliquot 2 μΐ gene specific RT primer into a 96 well optical plate; add them vertically( from top to bottom);

[0223] (b) Preparing following cDNA synthesis reagents mix as below, assuming you have 5 genes and 8 samples to test. Scale up or down if necessary. Reagents lx Total needed (5x8+15%extra)(ul)

10 niM dNTPs 1.0 μΐ (5x8+15%extra) = 46

Superscript III 0.15μ1 0.15μ1 χ 46 lOx RT buffer 1.0 μΐ 1 μΐ χ 46

Rnase inhibitor 0.1 μΐ 0.1μ1 χ 46

0.1 M DTT 1.0 μΐ 1 μΐ χ 46

RNase free water 0.75 μΐ 0.75μ1 χ 46

MgC12(50 mM) 2 μ1 2 μΐ χ 46

[0224] (c) Prepare a number of micro centrifuge tube, add 2μ1 RNA for each gene tested

(5 gene χ 2.2 μΐ =11 μΐ) to each tube. Add proper amount of reaction mix (6 μΐ + 10% extra, for 5 genes, you need 33 μΐ). Mix well.

[0225] (d) For each reaction, aliquot 8 μΐ to each well, add horizontally (from 1 to 12). Mix 3-4 times by pipette up and down.

[0226] (e) Seal the plate top with a self-adherent membrane. Spin briefly.

[0227] (f) Run the reaction a PCR machine; using the program MICRODNA. The following parameter values to the thermal cycler are shown as follows:

Step type Time(minutes) Temperature (°C)

Hold 30 16

Hold 30 42

Hold 5 85

Hold oo 4

3. Performing quantitative reverse transcription-PCR (qRT-PCR) [0228] (a) Prepare a set of micro-centrifuge tubes, label them according to micorRNA gene. Prepare gene specific PCR mix, for example, if you have 8 samples

Reagents lx 8 sample

Gene specific PCR Primer 1.0 μΐ lul x 8 + 10% extra = 8.8 lx Taqman reaction mix 17.7 μΐ 17.7 x 8 + 10% extra = 156.4

[0229] (b) Add 1.3 μΐ cDNA, prepared from step 2, to the corresponding well in a 96 well optical plate.

[0230] (c) Add 18.7

gene specific PCR mix to each well; match cDNA primer with PCR primer correctly. Pipette 3 or 4 times, sealed and spin briefly.

[0231] (d) Load the plate into Realtime PCR machine (Applied Biosystem's 7300 Real time PCR System using 7300 system SDS Software), We used the Relative Quantization Plate Method for measurement of PCR cycling. Thermal cycling conditions are shown as follows: Hold denature anneal/extend (45 cycles)

95°C 95°C 60°C

10 min 15 seconds 60 seconds

MicroRNA array and real time PCR

[0232] Allospecific CD8⁺ Ts cells, generated as described⁹'¹¹, were analyzed as follows. Five microgram of total RNA prepared from these cells using Trizol® (Invitrogen), were annealed to oligonucleotide primer mix and hybridized to 132 miRNA oligonucleotide probes. Streptavidin- HRP chemiluminescence was used for detection of micro RNA expression (Signosis). Real-time PCR detection of microRNA was performed using TaqMan® Small RNA assays (Applied Biosystems).

Statistical Analysis [0233] Differences between control and experimental groups were compared using chi-square test. P-value < 0,05 was considered statistically significant.

[0234] The threshold cycle (CT) is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. The CT values of various genes, including C. elegans miPv-39 which is used as a control, can be obtained. The relative Δ CT (CT of a given gene subtracts CT of C.elegans miR-39) is calculated. The relative expression of a given gene is expressed as 2^" Δ CT . In order to calculate the percentage of up-regulation from its pre-transplant baseline, the relative expression of a given gene is converted to its decimal value.

For example:

[0235] Δ CT of miPv-21 in serum obtained pre-transplant = 10.856, converts to its decimal value:

Pre-transplantation— 2^~1U =0.000539533,

[0236] Δ CT of miPv-21 in serum obtained post-transplant with high-grade rejection (2R/3A) =

-10 230

10.230, converts to its decimal value: 2^" Post-transpiantation = 2^{" '} = 0.000832651 [0237] To calculate % up-regulation from pre-transplant baseline: % Up-regulation =

[(2 Post-transplantation - 2 Pre-transplantation)/ 2 Pre-transplantation] X 100%

% Up-regulation = [(0.000832651 - 0.000539533)/0.000539533] x 100% = 54.3%

[0238] In the present specification, the invention has been described with reference to specific embodiments thereof. It will, however, be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention. The specification and drawings are, accordingly, to be regarded in an illustrative rather than a restrictive sense. The contents of all references, pending patent applications and published patents, cited throughout this application are hereby expressly incorporated by reference as if set forth herein in their entirety, except where terminology is not consistent with the definitions herein. Although specific terms are employed, they are used as in the art unless otherwise indicated. REFERENCES

1. Vlad G, Cortesini R, Suciu-Foca N. License to heal: bidirectional interaction of antigen- specific regulatory T cells and tolerogenic APC. J Immunol 2005;174:5907-14.

2. Cella M, Dohring C, Samaridis J, et al. A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med 1997;185: 1743-51.

3. Chang CC, Ciubotariu R, Manavalan JS, et al. Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 2002;3:237-43.

4. Manavalan JS, Rossi PC, Vlad G, et al. High expression of ILT3 and ILT4 is a general feature of tolerogenic dendritic cells. Transpl Immunol 2003;11:245-58.

5. Penna G, Roncari A, Amuchastegui S, et al. Expression of the inhibitory receptor ILT3 on dendritic cells is dispensable for induction of CD4+Foxp3+ regulatory T cells by 1,25- dihydroxyvitamin D3. Blood 2005;106:3490-7.

6. Adorini L, Penna G. Induction of tolerogenic dendritic cells by vitamin D receptor agonists. Handb Exp Pharmacol 2009:251-73.

7. Adorini L, Penna G. Dendritic cell tolerogenicity: a key mechanism in immunomodulation by vitamin D receptor agonists. Hum Immunol 2009;70:345-52.

8. Chang CC, Liu Z, Vlad G, et al. Ig-like transcript 3 regulates expression of proinflammatory cytokines and migration of activated T cells. J Immunol 2009;182:5208-16.

9. Kim-Schulze S, Scotto L, Vlad G, et al. Recombinant Ig-like transcript 3-Fc modulates T cell responses via induction of Th anergy and differentiation of CD8+ T suppressor cells. J Immunol 2006;176:2790-8.

10. Vlad G, D'Agati VD, Zhang QY, et al. Immunoglobulin-like transcript 3-Fc suppresses T-cell responses to allogeneic human islet transplants in hu-NOD/SCID mice. Diabetes 2008;57: 1878-86.

11. Chang CC, Vlad G, D'Agati VD, et al. BCL6 is required for differentiation of Ig-like transcript 3-Fc-induced CD8+ T suppressor cells. J Immunol 2010;185:5714-22. 12. Vlad G, King J, Chang CC, et al. Gene profile analysis of CD8(+) ILT3Fc induced T suppressor cells. Hum Immunol 2011;72: 107-14.

13. Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 2010;466:835-40.

14. Liston A, Lu LF, O'Carroll D, Tarakhovsky A, Rudensky AY. Dicer-dependent microRNA pathway safeguards regulatory T cell function. J Exp Med 2008;205: 1993-2004.

15. Zhou X, Jeker LT, Fife BT, et al. Selective miR disruption in T reg cells leads to uncontrolled autoimmunity. J Exp Med 2008;205: 1983-91.

16. Lang R, Hammer M, Mages J. DUSP meet immunology: dual specificity MAPK phosphatases in control of the inflammatory response. J Immunol 2006;177:7497-504.

17. Tzachanis D, Freeman GJ, Hirano N, et al. Tob is a negative regulator of activation that is expressed in anergic and quiescent T cells. Nat Immunol 2001;2: 1174-82.

18. Tzachanis D, Li L, Lafuente EM, Berezovskaya A, Freeman GJ, Boussiotis VA. Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-beta signaling in activated T lymphocytes. Blood 2007;109:2944-52.

19. Labbaye C, Spinello I, Quaranta MT, et al. A three-step pathway comprising PLZF/miR- 146a/CXCR4 controls megakaryopoiesis. Nat Cell Biol 2008;10:788-801.

20. Kim YJ, Hwang SJ, Bae YC, Jung JS. MiR-21 regulates adipogenic differentiation through the modulation of TGF-beta signaling in mesenchymal stem cells derived from human adipose tissue. Stem Cells 2009;27:3093-102.

21. Frankel LB, Christoffersen NR, Jacobsen A, Lindow M, Krogh A, Lund AH. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem 2008;283: 1026-33.

22. Lu C, Huang X, Zhang X, et al. miR-221 and miR- 155 regulate human dendritic cell development, apoptosis, and IL-12 production through targeting of p27kipl, KPCl, and SOCS-1. Blood 2011;117:4293-303.

23. Lu LF, Boldin MP, Chaudhry A, et al. Function of miR-146a in controlling T suppressor cells cell-mediated regulation of Thl responses. Cell 2010;142:914-29. 24. Murphy LO, Smith S, Chen RH, Fingar DC, Blenis J. Molecular interpretation of ERK signal duration by immediate early gene products. Nat Cell Biol 2002;4:556-64.

25. Okazaki K, Sagata N. The Mos/MAP kinase pathway stabilizes c-Fos by phosphorylation and augments its transforming activity in NIH 3T3 cells. EMBO J 1995;14:5048-59.

26. Sasaki T, Kojima H, Kishimoto R, Ikeda A, Kunimoto H, Nakajima K. Spatiotemporal regulation of c-Fos by ERK5 and the E3 ubiquitin ligase UBRl, and its biological role. Mol Cell 2006;24:63-75.

27. Divekar AA, Dubey S, Gangalum PR, Singh RR. Dicer insufficiency and microRNA- 155 overexpression in lupus regulatory T cells: an apparent paradox in the setting of an inflammatory milieu. J Immunol 2011;186:924-30.

28. Rouas R, Fayyad-Kazan H, El Zein N, et al. Human natural T suppressor cells microRNA signature: role of microRNA-31 and microRNA-21 in FOXP3 expression. Eur J Immunol 2009;39: 1608-18.

29. Ziegler SF. FOXP3: of mice and men. Annu Rev Immunol 2006;24:209-26.

30. Vilches C, Parham P. KIR: diverse, rapidly evolving receptors of innate and adaptive immunity. Annu Rev Immunol 2002;20:217-51.

31. Palmer DC, Restifo NP. Suppressors of cytokine signaling (SOCS) in T cell differentiation, maturation, and function. Trends Immunol 2009;30:592-602.

32. Zhang Y, Blattman JN, Kennedy NJ, et al. Regulation of innate and adaptive immune responses by MAP kinase phosphatase 5. Nature 2004;430:793-7.

33. Durr C, Pfeifer D, Claus R, et al. CXCL12 mediates immunosuppression in the lymphoma microenvironment after allogeneic transplantation of hematopoietic cells. Cancer Res 2010;70: 10170-81.

34. Lin J, Lwin T, Zhao JJ, et al. Follicular dendritic cell-induced microRNA-mediated upregulation of PRDM1 and downregulation of BCL-6 in non-Hodgkin's B-cell lymphomas. Leukemia 2011;25: 145-52.

35. Fujita S, Ito T, Mizutani T, et al. miR-21 Gene expression triggered by AP-1 is sustained through a double-negative feedback mechanism. J Mol Biol 2008;378:492-504. 36. Yin Q, Wang X, McBride J, Fewell C, Flemington E. B-cell receptor activation induces BIC/miR-155 expression through a conserved AP-1 element. J Biol Chem 2008;283:2654-62.

37. Taganov KD, Boldin MP, Chang KJ, Baltimore D. NF-kappaB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A 2006;103: 12481-6.

38. Owens DM, Keyse SM. Differential regulation of MAP kinase signalling by dual- specificity protein phosphatases. Oncogene 2007;26:3203-13.

39. Armstrong AJ, Gebre AK, Parks JS, Hedrick CC. ATP-binding cassette transporter Gl negatively regulates thymocyte and peripheral lymphocyte proliferation. J Immunol 2010;184: 173-83.

40. Singh K, Deshpande P, Pryshchep S, et al. ERK-dependent T cell receptor threshold calibration in rheumatoid arthritis. J Immunol 2009;183:8258-67.

41. Beinhauer BG, McBride JM, Graf P, et. al. Interleukin 10 regulates cell surface and soluble LIR-2 (CD85d) expression on dendritic cells resulting in T cell hyporesponsiveness in vitro. Eur J Immunol. 2004;34(l):74-80.

42. Ye BH, Chaganti S, Chang CC, et al. Chromosomal translocations cause deregulated BCL6 expression by promoter substitution in B cell lymphoma. EMBO J 1995;14:6209-17.

43. Valadi H, Ekstrom k, Bossios A, et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nature Cell Biol. 2007;9:654-657.

44. Oligonucleotide synthesis, a practical approach, Ed. M. J. Gait, IRL Press, 1984.

45. Oligonucleotides and Analogues, A Practical Approach", Ed. F. Eckstein, IRL Press, 1991 Chapter 1, Chapter 2, Chapter 4, Chapter 5, Chapter 6, and Chapter 7.

46. Martin, P., Helv. Chian. Acta, 1995, 78, 486-504;

47. Beaucage, S. L. and Iyer, R. P., Tetrahedron, 1992, 48, 2223-2311.

48. Beaucage, S. L. and Iyer, R. P., Tetrahedron, 1993, 49, 6123-6194

Claims

What is claimed is:

1. A method, comprising: a) identifying a subject that has a disorder associated with an abnormally high immune response, b) administering to the subject a therapeutically effective amount of immunosuppressive agents that reduce the expression or biological activity of at least two miRs selected from the group consisting of: miR 30b, miR 155, miR-146a and miR 21, wherein the agents are selected from the group comprising (i) antisense DNA or RNA or chimeras thereof, small interfering RNA (siRNA), micro RNA (miRNA), short hairpin RNA, ribozymes, antagomiRs, antimiRs, supermiR, and aptamers, and (ii) oligonucleotides comprising the binding site in BCL6 mRNA for miR 30b, the binding site in SOCS l mRNA for miR 155, the binding site in CXCR4 mRNA for miR-146a and the binding site in DUSP10 mRNA for miR 21, or biologically active fragments of the respective binding sites, wherein the therapeutically effective amount is an amount that reduces the abnormally high immune response thereby treating the disorder.

2. The method of claim 1, further comprising administering one or more proteins selected from the group consisting of: BCL6, SOCS l, CXCR4, and DUSP10.

3. The method of claim 1, wherein the disorder is selected from the group consisting of: transplant rejection, an autoimmune disease, graft vs. host disease, and inflammation.

4. The method of claim 1, wherein the subject is human.

5. The method of claim 3, wherein the autoimmune disorder is selected from the group consisting of: rheumatoid sclerosis, arthritis, Crohn's disease, diabetes, multiple systemic lupus erythematosus, lupus vulgaris, thyroiditis, Celiac disease, Sjogren's syndrome, Churg-Strauss Syndrome, Graves' disease and idiopathic thrombocytopenic purpura.

6. The method of claim 1, wherein the immune response is mediated by activated T cells.

7. A method, comprising: a) identifying a subject afflicted with a disorder associated with an abnormally high immune response b) obtaining T cells from the subject, c) maintaining the T cells under conditions that induce the T cells to differentiate into T suppressor cells, d) contacting the isolated T cells in vitro with immunosuppressive agents that reduce the expression or biological activity of at least two miRs selected from the group consisting of miR 30b, miR 155, miR-146a and miR 21, wherein the agents are selected from the group comprising

(i) antisense DNA or RNA or chimeras thereof, small interfering RNA (siRNA), micro RNA (miRNA), short hairpin RNA, ribozymes, antagomiRs, antimiRs, supermiR, and aptamers, and

(ii) oligonucleotides comprising the binding site in BCL6 mRNA for miR 30b, the binding site in SOCS 1 mRNA for miR 155, the binding site in CXCR4 mRNA for miR-146a and the binding site in DUSP10 mRNA for miR 21, or biologically active fragments of the respective binding sites, wherein the immunosuppressive agents are provided in an amount that induces the T cells to differentiate into T suppressor cells, e) identifying and collecting T suppressor cells, and f) intravenously administering the T suppressor cells to the subject in a therapeutically effective amount that reduces the abnormally high immune response, thereby treating the disorder.

8. The method of claim 7, wherein the T cell is a CD4+ T cell, a CDS+ T cell, or a CD8+ T cell.

9. A pharmaceutical formulation, comprising therapeutically effective amounts of immunosuppressive oligonucleotides that reduce the expression or biological activity of at least two miRs selected from the group consisting of miR 30b, miR 155, miR-146a and miR 21, wherein the agents are selected from the group comprising (i) antisense DNA or RNA or chimeras thereof, small interfering RNA (siRNA), micro RNA (miRNA), short hairpin RNA, ribozymes, antagomiRs, antimiRs, supermiR, and aptamers, and (ii) oligonucleotides comprising the binding site in BCL6 mRNA for miR 30b, the binding site in SOCS 1 mRNA for miR 155, the binding site in CXCR4 mRNA for miR-146a and the binding site in DUSPIO mRNA for miR 21, or biologically active fragments of the respective binding sites.

10. A pharmaceutical formulation comprising therapeutically effective amounts of immuno stimulatory oligonucleotides that increase the expression of at least two miRs selected from group consisting of miR-30b, miR-146a, miR-155, and miR 21 or reduce the expression of at least two proteins selected from the group consisting of BCL6, SOCS 1, CXCR4, and

DUSPIO.

11. The method of claim 10, wherein the oligonucleotide is selected from the group comprising miR-30b mimetics, miR-146a mimetics, miR-155 mimetics, and miR 21 mimetics.

12. A method, comprising a) obtaining a pre-allograft serum sample from a subject undergoing a heart allograft and determining a pre-allograft level of miR21 in the sample, b) obtaining a post-allograft serum sample from the subject, and determining a post-allograft level of miR21 in the sample, c) comparing the miR21 level in the pre-allograft and post-allograft samples, and d) if the miR21 level in the post-allograft sample is more than about 20% higher than the miR21 level in the pre-allograft level, then determining that the subject has a grade 2R/3A rejection.

13. The method of claim 12, further comprising e) treating the subject for 2R/3A rejection.

14. The method of claim 12, further comprising e) performing a biopsy to confirm the diagnosis of 2R/3A rejection.