WO2023081767A1

WO2023081767A1 - Methods for immunotherapy

Info

Publication number: WO2023081767A1
Application number: PCT/US2022/079234
Authority: WO
Inventors: Michelle Brenda PIRES; Aaron Martin; Daniel T. MACLEOD; Alan F. List
Original assignee: Precision Biosciences, Inc.
Priority date: 2021-11-05
Filing date: 2022-11-03
Publication date: 2023-05-11

Abstract

The present invention encompasses methods of reducing the number of target cells in a subject, reducing host rejection of genetically-modified immune cells, and/or reducing the killing of genetically-modified immune cells by nucleoside analogs. In particular, the methods of the invention utilize genetically-modified immune cells comprising an engineered antigen receptor that have reduced expression of deoxycytidine kinase (dCK) protein.

Description

METHODS FOR IMMUNOTHERAPY

FIELD OF THE INVENTION

The invention relates to the field of oncology and immunotherapy. In particular, the invention relates to allogeneic cellular immunotherapy and lymphodepletion regimens.

REFERENCE TO A SEQUENCE LISTING

The contents of the electronic sequence listing (P109070066WO00-SEQ-EPG.xml; Size: 28,750 bytes; and Date of Creation: November 3, 2022) is herein incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

T cell adoptive immunotherapy is a promising approach for cancer treatment. The immunotherapy treatment methods disclosed herein utilize isolated human T cells that have been genetically-modified to enhance their specificity for a specific tumor associated antigen. Genetic modification may involve the expression of a chimeric antigen receptor or an exogenous T cell receptor to graft antigen specificity onto the T cell. In contrast to exogenous T cell receptors, chimeric antigen receptors derive their specificity from the variable domains of a monoclonal antibody. Thus, T cells expressing chimeric antigen receptors (CAR T cells) induce tumor immunoreactivity in a major histocompatibility complex non-restricted manner. T cell adoptive immunotherapy has been utilized as a clinical therapy for a number of cancers, including B cell malignancies (e.g., acute lymphoblastic leukemia, B cell non-Hodgkin lymphoma, acute myeloid leukemia, and chronic lymphocytic leukemia), multiple myeloma, neuroblastoma, glioblastoma, advanced gliomas, ovarian cancer, mesothelioma, melanoma, prostate cancer, pancreatic cancer, and others.

Despite its potential usefulness as a cancer treatment, adoptive immunotherapy with CAR T cells has been limited, in part, by expression of the endogenous T cell receptor on the cell surface. CAR T cells expressing an endogenous T cell receptor may recognize major and minor histocompatibility antigens following administration to an allogeneic patient, which can lead to the development of graft-versus-host-disease (GVHD). As a result, clinical trials have largely focused on the use of autologous CAR T cells, wherein a patient’s T cells are isolated, genetically-modified to incorporate a chimeric antigen receptor, and then re-infused into the same patient. An autologous approach provides immune tolerance to the administered CAR T cells; however, this approach is constrained by both the time and expense necessary to produce patient-specific CAR T cells after a patient’s cancer has been diagnosed.

Thus, it would be advantageous to develop “off the shelf’ CAR T cells, prepared using T cells from a third party, healthy donor, that have reduced expression, or have no detectable cell surface expression of an endogenous T cell receptor (e.g., an alpha/beta T cell receptor) and do not initiate GvHD upon administration. Such products could be generated and validated in advance of diagnosis and could be made available to patients as soon as necessary. Therefore, a need exists for the development of allogeneic CAR T cells that lack an endogenous T cell receptor in order to prevent the occurrence of GvHD.

Clinical outcomes in CAR T therapy correlate with engraftment, expansion, and persistence of CAR T cells. In order to facilitate engraftment and expansion, a lymphodepletion regimen consisting of cyclophosphamide and fludarabine precedes CAR T infusion. This creates niches for infused CAR T cells and stimulates beneficial homeostatic cytokine production. As these compounds are also toxic to CAR T cells, administering the proper doses of both the conditioning drugs and the cell therapies with appropriate timing can be a challenge.

SUMMARY OF THE INVENTION

The present disclosure describes methods and compositions for protecting CAR T cells from fludarabine toxicity by knocking down the gene deoxycytidine kinase (dCK), which converts fludarabine from the prodrug form to an active compound resulting in Fludarabine resistant allogeneic CAR T (FluR CAR T) useful for cellular immunotherapies.

In one aspect, the invention provides a method of reducing the number of target cells in a subject, the method comprising: (a) administering to the subject a lymphodepletion regimen comprising an effective dose of one or more chemotherapeutic lymphodepletion agents; and (b) administering to the subject an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are genetically-modified human immune cells; wherein the genetically- modified human immune cells comprise a cell surface engineered antigen receptor having specificity for an antigen on the target cells; wherein the genetically-modified human immune cells exhibit reduced expression of deoxycytidine kinase (dCK) protein compared to control cells; wherein the one or more chemotherapeutic lymphodepletion agents includes a nucleoside analog; and wherein the method reduces the number of the target cells in the subject. In some embodiments, the number of target cells in the subject is reduced relative to the same method wherein the genetically-modified human immune cells do not exhibit reduced expression of dCK protein compared to control cells.

In another aspect, the invention provides a method for reducing host rejection of genetically-modified human immune cells in a subject, the method comprising: (a) administering to the subject a lymphodepletion regimen comprising an effective dose of one or more chemotherapeutic lymphodepletion agents; and (b) administering to the subject an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are the genetically-modified human immune cells; wherein the genetically-modified human immune cells comprise a cell surface engineered antigen receptor having specificity for an antigen on target cells in the subject; wherein the genetically-modified human immune cells exhibit reduced expression of dCK protein compared to control cells; wherein the one or more chemotherapeutic lymphodepletion agents includes a nucleoside analog; and wherein rejection of the genetically-modified human immune cells by host immune cells is reduced (e.g., reduced relative to control genetically-modified human immune cells that are not modified to have reduced expression of dCK protein). In some embodiments, the rejection of the genetically- modified human immune cells by host immune cells is reduced relative to the same method wherein the genetically-modified human immune cells do not exhibit reduced expression of dCK protein compared to control cells.

In another aspect, the invention provides a method for reducing nucleoside analog- induced killing of genetically-modified human immune cells in a subject, the method comprising: (a) administering to the subject a lymphodepletion regimen comprising an effective dose of one or more chemotherapeutic lymphodepletion agents; and (b) administering to the subject an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are genetically-modified human immune cells; wherein the genetically-modified human immune cells comprise a cell surface engineered antigen receptor having specificity for an antigen on target cells in the subject; wherein the genetically-modified human immune cells exhibit reduced expression of dCK protein compared to control cells; wherein the one or more chemotherapeutic lymphodepletion agents includes the nucleoside analog; and wherein nucleoside analog-induced killing of the genetically-modified human immune cells is reduced (e.g., reduced relative to control genetically-modified human immune cells that are not modified to have reduced expression of dCK protein). In some embodiments, nucleoside analog-induced killing of the genetically-modified human immune cells is reduced relative to the same method wherein the genetically-modified human immune cells do not exhibit reduced expression of dCK protein compared to control cells.

In some embodiments, the genetically-modified human immune cells exhibit greater resistance (e.g., cell survival, cell expansion, target cell killing) to the nucleoside analog compared to control cells that do not exhibit reduced expression of dCK protein.

In some embodiments, the human immune cells are human T cells. In some embodiments, the human immune cells are human natural killer (NK cells). In some embodiments, the human immune cells are human macrophages. In some embodiments, the human immune cells are human B cells.

In some embodiments, the human immune cells are not derived from the subject.

In some embodiments, the engineered antigen receptor is a chimeric antigen receptor (CAR). In some embodiments, the engineered antigen receptor is an exogenous T cell receptor (TCR).

In some embodiments, the genetically-modified human immune cells comprise in their genome a polynucleotide comprising a nucleic acid sequence encoding the engineered antigen receptor. In some embodiments, the polynucleotide comprises an exogenous promoter that is operably linked to the nucleic acid sequence encoding the engineered antigen receptor. In some embodiments, the promoter is a Pol II promoter. In some embodiments, the Pol II promoter is a JET promoter or an EFl-alpha promoter. In some embodiments, the polynucleotide comprises a termination sequence.

In some embodiments, the polynucleotide is positioned within a gene, and expression of the gene is disrupted by the polynucleotide. In some embodiments, the gene is a T cell receptor alpha gene. In some embodiments, the gene is a T cell receptor alpha constant region (TRAC) gene. In some embodiments, the gene is a T cell receptor beta gene. In some embodiments, the gene is a T cell receptor beta constant region (TRBC) gene. In some particular embodiments, the gene is a TRAC gene, and the polynucleotide is positioned within SEQ ID NO: 1. In some particular embodiments, the gene is a TRAC gene, and the polynucleotide is positioned between nucleotide 13 and 14 of SEQ ID NO: 1. In some embodiments, the genetically-modified human immune cells do not have detectable cell surface expression of an endogenous alpha/beta TCR. In some embodiments, the genetically- modified human immune cells do not have detectable cell surface expression of an endogenous CD3. In some embodiments, the genetically-modified human immune cells comprise an inhibitory molecule that is inhibitory against dCK. In some embodiments, the inhibitory molecule is an inhibitory nucleic acid molecule. In some embodiments, the inhibitory nucleic acid molecule is an RNA interference (RNAi) molecule. In some embodiments, the RNAi molecule is a short hairpin RNA (shRNA). In some embodiments, the RNAi molecule is a small interfering RNA (siRNA). In some embodiments, the RNAi molecule is a microRNA (miRNA).

In some embodiments, the RNAi molecule is a microRNA- adapted shRNA (shRNAmiR). In some embodiments, the shRNAmiR comprises, from 5' to 3': (a) a 5' miR scaffold domain; (b) a 5' miR basal stem domain; (c) a passenger strand; (d) a miR loop domain; (e) a guide strand; (f) a 3' miR basal stem domain; and (g) a 3' miR scaffold domain. In some embodiments, the miR loop domain is a miR-30a loop domain, a miR- 15 loop domain, a miR- 16 loop domain, a miR- 155 loop domain, a miR-22 loop domain, a miR- 103 loop domain, or a miR- 107 loop domain. In particular embodiments, the miR loop domain is a miR-30a loop domain.

In certain embodiments, the miR-30a loop domain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to SEQ ID NO: 19. In particular embodiments, the miR-30a loop domain comprises a nucleic acid sequence of SEQ ID NO: 19.

In some embodiments, the shRNAmiR comprises a microRNA-E (miR-E) scaffold, a miR-30 (e.g., miR-30a) scaffold, a miR-15 scaffold, a miR-16 scaffold, a miR-155 scaffold, a miR-22 scaffold, a miR- 103 scaffold, or a miR- 107 scaffold. In certain embodiments, the shRNAmiR comprises a miR-E scaffold.

In some embodiments, the shRNAmiR comprises a structure wherein: (a) the 5' miR scaffold domain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to SEQ ID NO: 17; (b) the 5' miR basal stem domain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to SEQ ID NO: 18; (c) the 3' miR basal stem domain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to SEQ ID NO: 20; and/or (d) the 3' miR scaffold domain comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to SEQ ID NO: 21.

In certain embodiments, the shRNAmiR comprises a structure wherein: (a) the 5' miR scaffold domain comprises a nucleic acid sequence of SEQ ID NO: 17; (b) the 5' miR basal stem domain comprises a nucleic acid sequence of SEQ ID NO: 18; (c) the 3' miR basal stem domain comprises a nucleic acid sequence of SEQ ID NO: 20; and (d) the 3' miR scaffold domain comprises a nucleic acid sequence of SEQ ID NO: 21.

In some embodiments, the shRNAmiR has a structure wherein the passenger strand comprises a nucleic acid sequence of SEQ ID NO: 7 and the guide strand comprises a nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the shRNAmiR has a structure wherein the passenger strand comprises a nucleic acid sequence of SEQ ID NO: 9 and the guide strand comprises a nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the shRNAmiR has a structure wherein the passenger strand comprises a nucleic acid sequence of SEQ ID NO: 11 and the guide strand comprises a nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the shRNAmiR has a structure wherein the passenger strand comprises a nucleic acid sequence of SEQ ID NO: 13 and the guide strand comprises a nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the shRNAmiR has a structure wherein the passenger strand comprises a nucleic acid sequence of SEQ ID NO: 15 and the guide strand comprises a nucleic acid sequence of SEQ ID NO: 16.

In some embodiments, the shRNAmiR comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to a sequence set forth in SEQ ID NO: 2. In some embodiments, the shRNAmiR comprises a nucleic acid sequence set forth in SEQ ID NO: 2.

In some embodiments, the shRNAmiR comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to a sequence set forth in SEQ ID NO: 3. In some embodiments, the shRNAmiR comprises a nucleic acid sequence set forth in SEQ ID NO: 3.

In some embodiments, the shRNAmiR comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to a sequence set forth in SEQ ID NO: 4. In some embodiments, the shRNAmiR comprises a nucleic acid sequence set forth in SEQ ID NO: 4.

In some embodiments, the shRNAmiR comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to a sequence set forth in SEQ ID NO: 5. In some embodiments, the shRNAmiR comprises a nucleic acid sequence set forth in SEQ ID NO: 5.

In some embodiments, the shRNAmiR comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, sequence identity to a sequence set forth in SEQ ID NO: 6. In some embodiments, the shRNAmiR comprises a nucleic acid sequence set forth in SEQ ID NO: 6.

In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 1% to about 99% compared to control cells. In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 5% to about 95% compared to control cells. In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 30% to about 90% compared to control cells. In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 50% to about 85% compared to control cells. In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 60% to about 80% compared to control cells. In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 65% to about 75% compared to control cells. In some embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of about 70% compared to control cells.

In some embodiments, the genetically-modified human immune cells comprise in their genome an inhibitor polynucleotide comprising a nucleic acid sequence encoding the inhibitory molecule. In some embodiments, the inhibitor polynucleotide comprises an exogenous promoter that is operably linked to the nucleic acid sequence encoding the inhibitory molecule. In some embodiments, the exogenous promoter is a Pol II or a Pol III promoter. In some embodiments, the Pol II promoter is a JET promoter or an EFl -alpha promoter. In some embodiments, the Pol III promoter is a U6 promoter. In some embodiments, the inhibitor polynucleotide comprises a termination sequence. In some embodiments, inhibitor polynucleotide is positioned within a gene, and expression of the gene is disrupted by the inhibitor polynucleotide. In some embodiments, the gene is a T cell receptor alpha gene. In some embodiments, the gene is a TRAC gene. In some embodiments, the gene is a T cell receptor beta gene. In some embodiments, the gene is a TRBC gene. In some embodiments, the gene is a TRAC gene, and the inhibitor polynucleotide is positioned within SEQ ID NO: 1. In some embodiments, the gene is a TRAC gene, and the inhibitor polynucleotide is positioned between nucleotide 13 and 14 of SEQ ID NO: 1.

In some embodiments, the genetically-modified human immune cells comprise in their genomes a cassette comprising the nucleic acid sequence encoding the engineered antigen receptor and the nucleic acid sequence encoding the inhibitory molecule. In some embodiments, the cassette comprises a first exogenous promoter that is operably linked to the nucleic acid sequence encoding the engineered antigen receptor, and a second exogenous promoter that is operably linked to the nucleic acid sequence encoding the inhibitory molecule. In some such embodiments, the first exogenous promoter is a Pol II promoter. In some such embodiments, the second exogenous promoter is a Pol II promoter or a Pol III promoter. In some embodiments, the Pol II promoter is a JET promoter or an EFl -alpha promoter. In some embodiments, the Pol III promoter is a U6 promoter. In some such embodiments, the cassette comprises a first termination sequence 5' downstream of the nucleic acid sequence encoding the engineered antigen receptor, and a second termination sequence 5' downstream of the nucleic acid sequence encoding the inhibitory molecule. In some embodiments, the cassette comprises an exogenous promoter that is operably linked to the nucleic acid sequence encoding the engineered antigen receptor and the nucleic acid sequence encoding the inhibitory molecule. In some such embodiments, the exogenous promoter is a Pol II promoter. In some embodiments, the Pol II promoter is a JET promoter or an EFl -alpha promoter. In some such embodiments, the cassette comprises a termination sequence downstream of the nucleic acid sequence encoding the engineered antigen receptor and the nucleic acid sequence encoding the inhibitory molecule. In some embodiments, the cassette is positioned within a gene, wherein expression of the gene is disrupted by the inhibitor polynucleotide. In some embodiments, the gene is a T cell receptor alpha gene. In some embodiments, the gene is a TRAC gene. In some embodiments, the gene is a T cell receptor beta gene. In some embodiments, the gene is a TRBC gene. In some embodiments, the gene is a TRAC gene, and the cassette is positioned within SEQ ID NO: 1. In some embodiments, the gene is a TRAC gene, and the cassette is positioned between nucleotide 13 and 14 of SEQ ID NO: 1.

In some embodiments, the cassette comprises a first exogenous promoter (e.g., a Pol II promoter), a nucleic acid sequence encoding an engineered antigen receptor (e.g., a CAR or an exogenous TCR) described herein that is operably linked to the first exogenous promoter, a first termination sequence (e.g., a polyA sequence) that terminates expression of the engineered antigen receptor, a second exogenous promoter (e.g., a Pol II or Pol III promoter), a nucleic acid sequence encoding an inhibitory molecule (e.g., shRNAmiR) described herein that is operably linked to the second exogenous promoter, and a second termination sequence (e.g., a polyA sequence) that terminates expression of the inhibitory molecule.

In some embodiments, the cassette comprises an exogenous promoter (e.g., a Pol II promoter), a nucleic acid sequence encoding an engineered antigen receptor (e.g., a CAR or an exogenous TCR) described herein, a nucleic acid sequence encoding an inhibitory molecule (e.g., shRNAmiR) described herein, and a termination sequence (e.g., a polyA sequence) that terminates expression of the engineered antigen receptor and the inhibitory molecule, wherein the exogenous promoter is operably linked to both the nucleic acid sequence encoding the engineered antigen receptor and the nucleic acid sequence encoding the inhibitory molecule.

In some embodiments, the genetically-modified human immune cells comprise an inactivated dCK gene. In some such embodiments, the genetically-modified human immune cells exhibit a reduction of dCK protein expression of about 100% compared to control cells.

In some embodiments, up to about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100% of the human immune cells in the population are genetically-modified human immune cells described herein.

In some embodiments, between about 20% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 30% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 40% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 50% to about 99% of the human immune cells in the population are genetically- modified human immune cells described herein. In some embodiments, between about 60% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 70% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 80% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 90% to about 99% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 50% to about 80% of the human immune cells in the population are genetically-modified human immune cells described herein. In some embodiments, between about 60% to about 70% of the human immune cells in the population are genetically-modified human immune cells described herein.

In some embodiments, the nucleoside analog is fludarabine.

In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject at a dose between about 10 to about 40 mg/m²/day. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject at a dose between about 20 to about 40 mg/m²/day. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject at a dose of about 30 mg/m²/day.

In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) daily for at least one day, or for multiple days, within 7 days prior to administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 5 days and ending 3 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 4 days and ending 2 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 3 days and ending 1 day prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 2 days prior and ending on the same day as administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 1 day prior and ending 1 day after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 5 days and ending 4 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 4 days and ending 3 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 3 days and ending 2 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 2 days and ending 1 day prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 1 day prior and ending on the same day as administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily starting on the same day as and ending 1 day after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 2 days and ending 4 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 3 days and ending 5 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 4 days and ending 6 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 5 days and ending 7 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 6 days and ending 8 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 7 days and ending 9 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 8 days and ending 10 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 9 days and ending 11 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 10 days and ending 12 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 11 days and ending 13 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 12 days and ending 14 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 13 days and ending 15 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 14 days and ending 16 days after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 2 days and ending 3 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 3 days and ending 4 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 4 days and ending 5 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 5 days and ending 6 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 6 days and ending 7 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 7 days and ending 8 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 8 days and ending 9 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 9 days and ending 10 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 10 days and ending 11 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 11 days and ending 12 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 12 days and ending 13 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 13 days and ending 14 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject daily starting 14 days and ending 15 days after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 2 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 3 days after administration of the pharmaceutical composition. In some embodiments, In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 4 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 5 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 6 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises readministering the nucleoside analog (e.g., fludarabine) to the subject once 7 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 8 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises readministering the nucleoside analog (e.g., fludarabine) to the subject once 9 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 10 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises readministering the nucleoside analog (e.g., fludarabine) to the subject once 11 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 12 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises readministering the nucleoside analog (e.g., fludarabine) to the subject once 13 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject once 14 days after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 1 day, starting 2 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 2 days, starting 2 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 3 days, starting 2 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 1 day, starting 3 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 2 days, starting 3 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 3 days, starting 3 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 1 day, starting 4 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 2 days, starting 4 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 3 days, starting 4 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 1 day, starting 5 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 2 days, starting 5 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 3 days, starting 5 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 1 day, starting 6 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 2 days, starting 6 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 3 days, starting 6 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 1 day, starting 7 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 2 days, starting 7 days after the last dose of the nucleoside analog. In some embodiments, the lymphodepletion regimen comprises re-administering the nucleoside analog (e.g., fludarabine) to the subject a second time daily for 3 days, starting 7 days after the last dose of the nucleoside analog.

In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily at a dose of about 30 mg/m²/day, starting 3 days and ending 1 day prior to administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is re-administered to the subject daily at a dose of about 30 mg/m²/day, starting 7 days and ending 9 days after administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is readministered to the subject daily at a dose of about 30 mg/m²/day, starting 8 days and ending 10 days after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering the nucleoside analog (e.g., fludarabine) to the subject daily at a dose of about 30 mg/m²/day, starting 2 days prior and ending the same day as administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is re-administered to the subject daily at a dose of about 30 mg/m²/day, starting 7 days and ending 9 days after administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is re-administered to the subject daily at a dose of about 30 mg/m²/day, starting 8 days and ending 10 days after administration of the pharmaceutical composition.

In some embodiments, the one or more chemotherapeutic agents includes cyclopho sphamide .

In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject at a dose between about 400 to about 1500 mg/m²/day. In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject at a dose between about 500 to about 1000 mg/m²/day. In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject at a dose of about 500 mg/m²/day.

In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject daily for at least one day, or for multiple days, within 7 days prior to administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject daily beginning 6 days and ending 4 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject daily beginning 5 days and ending 3 days prior to administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject daily beginning 4 days and ending 2 days prior to administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject daily at a dose of about 500 mg/m²/day, starting 5 days and ending 3 days prior to administration of the pharmaceutical composition, and administering the nucleoside analog (e.g., fludarabine) to the subject daily at a dose of about 30 mg/m²/day, starting 3 days and ending 1 day prior to administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is re-administered to the subject daily at a dose of about 30 mg/m²/day, starting 7 days and ending 9 days after administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is readministered to the subject daily at a dose of about 30 mg/m²/day, starting 8 days and ending 10 days after administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering cyclophosphamide to the subject daily at a dose of about 500 mg/m²/day, starting 5 days and ending 3 days prior to administration of the pharmaceutical composition, and administering the nucleoside analog (e.g., fludarabine) to the subject daily at a dose of about 30 mg/m²/day, starting 2 days prior and ending the same day as administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is re-administered to the subject daily at a dose of about 30 mg/m²/day, starting 7 days and ending 9 days after administration of the pharmaceutical composition. In some such embodiments, the nucleoside analog is re-administered to the subject daily at a dose of about 30 mg/m²/day, starting 8 days and ending 10 days after administration of the pharmaceutical composition.

In some embodiments, the pharmaceutical composition is administered to the subject at a dose between about 0.3xl0⁶ to about 6.0xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 0.5xl0⁶ to about 3.0xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 0.5xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about l.OxlO⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 1.5xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 2.0xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 2.5xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 3.0xl0⁶ genetically-modified human immune cells/kg. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 270xl0⁶ genetically-modified human immune cells. In some embodiments, the pharmaceutical composition is administered to the subject at a dose of about 500xl0⁶ genetically-modified human immune cells.

In some embodiments, the lymphodepletion regimen comprises administering to the subject an effective amount of a biological lymphodepletion agent. In some embodiments, the biological lymphodepletion agent is an antibody. In some embodiments, the antibody has specificity for a cell surface antigen present on endogenous T cells. In some embodiments, the cell surface antigen is CD3. In some embodiments, the cell surface antigen is CD52.

In some embodiments, the lymphodepletion regimen does not comprise administering to the subject a biological lymphodepletion agent.

In some embodiments, the target cells are cancer cells. In some embodiments, the method reduces the size of the cancer in the subject. In some embodiments, the method eradicates the cancer in the subject. In some embodiments, the method is a method of immunotherapy .

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1A illustrates an AAV vector comprising a donor template for CAR T cell production. Figure IB illustrates an experimental workflow to characterize CAR T cell proliferative capacity and resistance properties to fludarabine.

Figure 2A shows the reduction of dCK mRNA abundance in CAR T cells comprising the dCK shRNAmiR. Figure 2B shows the number of viable CAR T cells over time in vitro in the presence or absence of fludarabine. Figure 2C provides a table summarizing enrichment of CD3-negative/CAR-positive cells observed following treatment of fludarabine- resistant (FluR) CAR T cells with fludarabine.

Figure 3 provides a table summarizing experimental groups for Example 2.

Figure 4 shows cell killing by CAR T cells in a real-time cell analysis (RTCA) assay in the presence or absence of fludarabine.

Figure 5 summarized the cytotoxicity observed in Figure 4.

Figure 6 illustrates the outline for an in vivo mouse study to evaluate FluR CAR T cells in the presence and absence of fludarabine.

Figure 7 shows the ventral average total flux observed in the in vivo study conducted in Example 3 of the present disclosure.

Figure 8 shows ventral flux images of mice evaluated in Example 3.

BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 sets forth the nucleic acid sequence of the TRC 1-2 recognition sequence within the TRAC gene.

SEQ ID NO: 2 sets forth the nucleic acid sequence of a 72136 dCK-specific shRNAmiR.

SEQ ID NO: 3 sets forth the nucleic acid sequence of a 72137 dCK-specific shRNAmiR.

SEQ ID NO: 4 sets forth the nucleic acid sequence of a 72138 dCK-specific shRNAmiR.

SEQ ID NO: 5 sets forth the nucleic acid sequence of a 72139 dCK-specific shRNAmiR.

SEQ ID NO: 6 sets forth the nucleic acid sequence of a 72140 dCK-specific shRNAmiR.

SEQ ID NO: 7 sets forth the nucleic acid sequence of the passenger strand of the

72136 dCK shRNAmiR.

SEQ ID NO: 8 sets forth the nucleic acid sequence of the guide strand of the 72136 dCK shRNAmiR.

SEQ ID NO: 9 sets forth the nucleic acid sequence of the passenger strand of the

72137 dCK shRNAmiR.

SEQ ID NO: 10 sets forth the nucleic acid sequence of the guide strand of the 72137 dCK shRNAmiR.

SEQ ID NO: 11 sets forth the nucleic acid sequence of the passenger strand of the

72138 dCK shRNAmiR.

SEQ ID NO: 12 sets forth the nucleic acid sequence of the guide strand of the 72138 dCK shRNAmiR.

SEQ ID NO: 13 sets forth the nucleic acid sequence of the passenger strand of the

72139 dCK shRNAmiR.

SEQ ID NO: 14 sets forth the nucleic acid sequence of the guide strand of the 72139 dCK shRNAmiR.

SEQ ID NO: 15 sets forth the nucleic acid sequence of the passenger strand of the

72140 dCK shRNAmiR.

SEQ ID NO: 16 sets forth the nucleic acid sequence of the guide strand of the 72140 dCK shRNAmiR.

SEQ ID NO: 17 sets forth the nucleic acid sequence of a 5' miR-E scaffold domain.

SEQ ID NO: 18 sets forth the nucleic acid sequence of a 5' miR-E basal stem domain. SEQ ID NO: 19 sets forth the nucleic acid sequence of a miR-30a loop domain.

SEQ ID NO: 20 sets forth the nucleic acid sequence of a 3' miR-E basal stem domain.

SEQ ID NO: 21 sets forth the nucleic acid sequence of a 3' miR-E scaffold domain.

DETAILED DESCRIPTION OF THE INVENTION

1. _ References and Definitions

The patent and scientific literature referred to herein establishes knowledge that is available to those of skill in the art. The issued US patents, allowed applications, published foreign applications, and references, including GenBank database sequences, which are cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference.

The present invention can be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. For example, features illustrated with respect to one embodiment can be incorporated into other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. In addition, numerous variations and additions to the embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

All publications, patent applications, patents, and other references mentioned herein are incorporated by reference herein in their entirety.

As used herein, “a,” “an,” or “the” can mean one or more than one. For example, “a” cell can mean a single cell or a multiplicity of cells.

As used herein, unless specifically indicated otherwise, the word “or” is used in the inclusive sense of “and/or” and not the exclusive sense of “either/or.”

As used herein, the term “deoxycytidine kinase” or “dCK” refers to the protein encoded by the human deoxycytidine kinase gene set forth in NCBI Gene ID No. 1633 (i.e., the Homo sapiens DCK gene), and naturally-occurring variants of the gene which still encode a wild-type dCK protein. The dCK protein phosphorylates several deoxyribonucleosides and their nucleoside analogs, and in the present disclosure, metabolizes nucleoside analogs used for lymphodepletion regimens (e.g., fludarabine) from their prodrug form to an active form.

As used herein, the term “lymphodepletion” or “lymphodepletion regimen” refers to the administration to a subject of one or more agents (e.g., chemotherapeutic lymphodepletion agents or biological lymphodepletion agents) capable of reducing endogenous lymphocytes in the subject for immunotherapy; e.g., a reduction of one or more lymphocytes (e.g., B cells, T cells, and/or NK cells) by at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or up to 100% relative to a control (e.g., relative to a starting amount in the subject undergoing treatment, relative to a pre-determined threshold, or relative to an untreated subject).

As used herein, the term “biological lymphodepletion agent” refers to a biological material, such an antibody, antibody fragment, antibody conjugate, or the like, that can be administered as part of a lymphodepletion regimen to reduce endogenous lymphocytes in the subject for immunotherapy. In some cases, such biological lymphodepletion agents can have specificity for antigens present on lymphocytes; e.g., CD52 or CD3.

As used herein, the term “chemotherapeutic lymphodepletion agents” refers to non- biological materials, such as small molecules, that can be administered as part of a lymphodepletion regimen to reduce endogenous lymphocytes in the subject for immunotherapy. In some examples, the chemotherapeutic lymphodepleting agent can be lymphodepleting but non-myeloablative.

As used herein, the term “nucleoside analogs” refers to a certain class of compounds useful in chemotherapy and lymphodepletion, particularly those that are metabolized by deoxycytidine kinase such that they are converted from a prodrug form to an active form. Nucleoside analogs useful in the invention can include, for example, fludarabine, cytarabine, gemcitabine, and decitabine.

As used herein, the term “effective dose”, “effective amount”, “therapeutically effective dose”, or “therapeutically effective amount,” as used herein, refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results. In some cases, an effective dose of a lymphodepletion agent is sufficient to reduce endogenous lymphocytes in the subject ; e.g., a reduction of one or more lymphocytes (e.g., B cells, T cells, and/or NK cells) by at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or up to 100% relative to a control (e.g., relative to a starting amount in the subject undergoing treatment of a disease, condition or disorder, relative to a pre-determined threshold, or relative to an untreated subject). In some embodiments, the effective dose is equivalent to the suggested, recommended or allowed dose (for adults or children) provided in the drug product labeling for a lymphodepletion agent. In other cases, an effective dose of an immunosuppressant agent is sufficient to reduce an immune response in the subject; e.g., a reduction in number of one or more immune cell types, activation of one or more lymphocyte type, or levels of one or more cytokines by at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or up to 100% relative to a control (e.g., relative to a starting amount in the subject, relative to a pre-determined threshold, or relative to an untreated subject). In some embodiments, the effective dose is equivalent to the suggested, recommended or allowed dose (for adults or children) provided in the drug product labeling for an immunosuppressant agent. In other cases, an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein the population comprises a plurality of genetically-modified human immune cells, and wherein the genetically-modified human immune cells express an engineered antigen receptor having specificity for an antigen on target cells, when administered in concert with a lymphodepletion regimen, is sufficient to reduce the target cells by at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or up to 100% relative to a control (e.g., relative to a starting amount in the subject, relative to a pre-determined threshold, or relative to an untreated subject). In some embodiments, the effective dose is equivalent to the suggested, recommended or allowed dose (for adults or children) provided in the drug product labeling for genetically-modified immune cells.

As used herein, the terms “treatment”, “treating”, or “treating a subject” refers to the administration of a pharmaceutical composition disclosed herein, comprising a population of human immune cells to a subject having a disease, disorder or condition. For example, the subject can have a disease such as cancer, and treatment can represent immunotherapy for the treatment of the disease. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, a partial or complete reduction in the number of cancer cells present in the subject, and remission or improved prognosis. In some aspects, treatment includes the administration of a lymphodepletion regimen to reduce endogenous lymphocytes in the subject for immunotherapy.

As used herein, “target cells” refers to cells that are desired to be reduced in number using the presently disclosed methods. According to the presently disclosed methods, the target cells express an antigen that can be targeted with genetically-modified human immune cells comprising an engineered antigen receptor, wherein the engineered antigen receptor comprises an extracellular ligand-binding domain having specificity for the antigen. In some embodiments, the antigen that is targeted with genetically-modified immune cells according to the presently disclosed methods is on the surface of the target cells. The target cells can be viral, bacterial, fungal, or human cells. The target cells can be disease-causing cells or cells associated with a particular disease state (e.g., autoimmune disease, cancer) or infection, such as cells infected with a virus, bacteria, fungus, or parasite. In some embodiments, the target cells are cancer cells. The target cells can be reduced using the presently disclosed methods. In some embodiments, the methods result in a reduction in the number of the target cells within the subject when compared to a control (e.g., relative to a starting amount in the subject prior to treatment according to the presently disclosed methods, relative to a predetermined threshold, relative to the same method wherein the genetically-modified human immune cells do not exhibit reduced expression of dCK protein compared to control cells, or relative to an untreated subject). That is, the number of target cells in the subject may be reduced by a percentage using the methods described herein. Such a reduction may be up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to 100%.

As used herein, the term “immune cell” refers to any cell that is part of the immune system (innate and/or adaptive) and is of hematopoietic origin. Non-limiting examples of immune cells include lymphocytes, B cells, T cells, monocytes, macrophages, dendritic cells, granulocytes, megakaryocytes, monocytes, macrophages, natural killer cells, myeloid-derived suppressor cells, innate lymphoid cells, platelets, red blood cells, thymocytes, leukocytes, neutrophils, mast cells, eosinophils, basophils, and granulocytes.

As used herein, the terms “T cell” and “T lymphocyte” are used interchangeably herein and refer to a white blood cell of the lymphocyte subtype that expresses T cell receptors on the cell membrane. T cells develop in the thymus gland and include both CD8+ T cells and CD4+ T cells, as well as natural killer T cells, memory T cells, gamma delta T cells, and any other lymphocytic cell that expresses a T cell receptor.

As used herein, the terms “human natural killer cell” or “human NK cell” or “natural killer cell” or “NK cell” refers to a type of cytotoxic lymphocyte critical to the innate immune system. The role NK cells play is analogous to that of cytotoxic T cells in the vertebrate adaptive immune response. NK cells provide rapid responses to virally infected cells and respond to tumor formation, acting at around 3 days after infection. Human NK cells, and cells derived therefrom, include isolated NK cells that have not been passaged in culture, NK cells that have been passaged and maintained under cell culture conditions without immortalization, and NK cells that have been immortalized and can be maintained under cell culture conditions indefinitely. In some cases, the human NK cell is a differentiated induced pluripotent stem cell (iPSC); e.g., an iPSC derived from a human somatic cell.

As used herein, the term “T cell receptor alpha gene” or “TCR alpha gene” refer to the locus in a T cell which encodes the T cell receptor alpha subunit. The T cell receptor alpha gene can refer to NCBI Gene ID number 6955, before or after rearrangement. Following rearrangement, the T cell receptor alpha gene comprises an endogenous promoter, rearranged V and J segments, the endogenous splice donor site, an intron, the endogenous splice acceptor site, and the T cell receptor alpha constant region locus, which comprises the subunit coding exons.

As used herein, the term “T cell receptor alpha constant region” or “TCR alpha constant region” or “TRAC” refers to a coding sequence of the T cell receptor alpha gene. The TCR alpha constant region includes the wild-type sequence, and functional variants thereof, identified by NCBI Gene ID NO. 28755.

As used herein, the term “T cell receptor beta gene” or “TCR beta gene” refers to the locus in a T cell which encodes the T cell receptor beta subunit. The T cell receptor beta gene can refer to NCBI Gene ID number 6957.

As used herein, the term “detectable cell surface expression of an endogenous alpha/beta TCR” refers to the ability to detect one or more components of the TCR complex (e.g., an alpha/beta TCR complex) on the cell surface of a T cell (e.g., a CAR T cell), or a population of T cells (e.g., CAR T cells) described herein, using standard experimental methods. Such methods can include, for example, immuno staining and/or flow cytometry specific for components of the TCR itself, such as a TCR alpha or TCR beta chain, or for components of the assembled cell surface TCR complex, such as CD3. Methods for detecting cell surface expression of an endogenous TCR (e.g., an alpha/beta TCR) on an immune cell include those described in MacLeod et al. (2017) Molecular Therapy 25(4): 949- 961.

As used herein, the term “no detectable cell surface expression of CD3” refers to lack of detection of CD3 on the surface of a T cell (e.g., a CAR T cell) described herein, or population of T cells (e.g., CAR T cells) described herein, as detected using standard experimental methods in the art. Methods for detecting cell surface expression of CD3 on an immune cell include those described in MacLeod et al. (2017).

As used herein, the terms “exogenous T cell receptor” or “exogenous TCR” refer to a TCR whose sequence is introduced into the genome of an immune effector cell (e.g., a human T cell) that may or may not endogenously express the TCR. Expression of an exogenous TCR on an immune effector cell can confer specificity for a specific epitope or antigen (e.g., an epitope or antigen preferentially present on the surface of a cancer cell or other diseasecausing cell or particle). Such exogenous T cell receptors can comprise alpha and beta chains or, alternatively, may comprise gamma and delta chains. Exogenous TCRs useful in the invention may have specificity to any antigen or epitope of interest. In some examples, exogenous TCRs can include an extracellular ligand-binding domain comprising an antibody, or antibody fragment, having specificity for a target antigen. Such an antibody fragment can be, for example, a single-chain variable fragment (scFv). An “exogenous T cell receptor” or “exogenous TCR” can also refer to a cell surface TCR complex that incorporates one or more genetically-modified and/or exogenous TCR components (e.g., a TRuC; see for example, WO2016187349, WO2018026953, WO2018067993, WO2018098365, WO2018119298, and WO202 1035170). Accordingly, in embodiments wherein a nucleic acid sequence encodes an “exogenous T cell receptor” or “exogenous TCR”, this can refer to a sequence encoding one or more genetically-modified and/or exogenous TCR complex components that, when expressed, associate with endogenous TCR components to form a functional modified TCR complex on the cell surface.

As used herein, the term “antibody” refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources. Antibodies can be tetramers of immunoglobulin molecules.

As used herein, the terms “antigen” or “Ag” refers to a molecule that is capable of being bound specifically by an antibody, or otherwise provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.

As used herein, the terms “tumor associated antigen” or “tumor antigen” or “hyperproliferative disorder antigen” or “antigen associated with a hyperproliferative disorder” refers to antigens that are common to specific hyperproliferative disorders. In certain aspects, the hyperproliferative disorder antigens of the present disclosure are derived from, cancers including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, NHL, leukemias, uterine cancer, cervical cancer, bladder cancer, kidney cancer and adenocarcinomas such as breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, and the like.

As used herein, the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present disclosure may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phagedisplay methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.

As used herein, the term “anti-CD52 antibody” refers to an antibody, or antibody fragment or conjugate, having specificity for a CD52 protein expressed on the cell surface of human T cells. In some examples, an anti-CD52 antibody can be a monoclonal antibody. In some cases, an anti-CD52 antibody can be alemtuzumab (i.e., CAMPATH). In some cases, an anti-CD52 antibody can be ALLO-647 (Allogene Therapeutics, San Francisco, CA).

As used herein, the term “anti-CD3 antibody” refers to an antibody, or antibody fragment or conjugate, having specificity for a CD3 protein expressed on the cell surface of human T cells. In some examples, an anti-CD3 antibody can be a monoclonal antibody. In some cases, an anti-CD3 antibody can be muromonab-CD3 (Orthoclone OKT3™), otelixizumab, teplizumab, foralumab, visilizumab, or derivatives thereof which have specificity for CD3.

As used herein, the term “chimeric antigen receptor” or “CAR” refers to an engineered receptor that confers or grafts specificity for an antigen onto an immune effector cell (e.g., a human T cell). A chimeric antigen receptor comprises at least an extracellular ligand-binding domain or moiety, a transmembrane domain, and an intracellular domain, wherein the intracellular domain comprises one or more signaling domains and/or costimulatory domains.

In some embodiments, the extracellular ligand-binding domain or moiety is an antibody, or antibody fragment. In this context, the term “antibody fragment” can refer to at least one portion of an antibody, that retains the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), a Fd fragment consisting of the VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either VE or VH), camelid VHH domains, multi- specific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody. An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide minibodies).

In some embodiments, the extracellular ligand-binding domain or moiety is in the form of a single-chain variable fragment (scFv) derived from a monoclonal antibody, which provides specificity for a particular epitope or antigen (e.g., an epitope or antigen preferentially present on the surface of a cell, such as a cancer cell or other disease-causing cell or particle). In some embodiments, the scFv is attached via a linker sequence. In some embodiments, the scFv is murine, humanized, or fully human.

The extracellular ligand-binding domain of a chimeric antigen receptor can also comprise an autoantigen (see, Payne et al. (2016), Science 353 (6295): 179-184), that can be recognized by autoantigen- specific B cell receptors on B lymphocytes, thus directing T cells to specifically target and kill autoreactive B lymphocytes in antibody-mediated autoimmune diseases. Such CARs can be referred to as chimeric autoantibody receptors (CAARs), and their use is encompassed by the invention. The extracellular ligand-binding domain of a chimeric antigen receptor can also comprise a naturally-occurring ligand for an antigen of interest, or a fragment of a naturally-occurring ligand which retains the ability to bind the antigen of interest.

The intracellular stimulatory domain includes one or more cytoplasmic signaling domains that transmit an activation signal to the T cell following antigen binding. Such cytoplasmic signaling domains can include, without limitation, a CD3 zeta signaling domain.

The intracellular stimulatory domain can also include one or more intracellular costimulatory domains that transmit a proliferative and/or cell- survival signal after ligand binding. In some cases, the co- stimulatory domain can comprise one or more TRAF-binding domains. Such TRAF binding-domains may include, for example, those set forth in SEQ ID NOs: 9-11. Such intracellular co- stimulatory domains can be any of those known in the art and can include, without limitation, those co-stimulatory domains disclosed in WO 2018/067697 including, for example, Novel 6 (“N6”). Further examples of co-stimulatory domains can include 4-1BB (CD137), CD27, CD28, CD8, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, or any combination thereof.

A chimeric antigen receptor further includes additional structural elements, including a transmembrane domain that is attached to the extracellular ligand-binding domain via a hinge or spacer sequence. The transmembrane domain can be derived from any membranebound or transmembrane protein. For example, the transmembrane polypeptide can be a subunit of the T-cell receptor (e.g., an a, p, y or polypeptide constituting CD3 complex), IL2 receptor p55 (a chain), p75 (P chain) or y chain, subunit chain of Fc receptors (e.g., Fey receptor III) or CD proteins such as the CD8 alpha chain. In certain examples, the transmembrane domain is a CD8 alpha domain. Alternatively, the transmembrane domain can be synthetic and can comprise predominantly hydrophobic residues such as leucine and valine.

The hinge region refers to any oligo or polypeptide that functions to link the transmembrane domain to the extracellular ligand-binding domain. For example, a hinge region may comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. Hinge regions may be derived from all or part of naturally occurring molecules, such as from all or part of the extracellular region of CD8, CD4 or CD28, or from all or part of an antibody constant region. Alternatively, the hinge region may be a synthetic sequence that corresponds to a naturally occurring hinge sequence or may be an entirely synthetic hinge sequence. In particular examples, a hinge domain can comprise a part of a human CD8 alpha chain, FcyRllla receptor or IgGl. In certain examples, the hinge region can be a CD8 alpha domain.

As used herein, the term “chimeric antigen receptor T cell” or “CAR T cell” refers to a human T cell modified to comprise a transgene encoding a CAR, wherein the CAR is expressed on the cell surface of the T cell.

As used herein, the term “proliferate in vivo” refers to an expansion in the number of genetically-modified human immune cells described herein in a subject following administration during immunotherapy. Such proliferation or expansion can be determined by methods known in the art and those shown in the examples herein, which include, for example, utilizing PCR analysis to determine the number of copies of a transgene (e.g., a CAR or exogenous TCR transgene) per mg of DNA isolated from peripheral blood mononuclear cells over a time course following administration of the pharmaceutical composition comprising the genetically-modified human immune cells.

As used herein, the term “cancer” should be understood to encompass any neoplastic disease (whether invasive or metastatic) which is characterized by abnormal and uncontrolled cell division causing malignant growth or tumor.

As used herein, the term “response,” “complete response,” “complete response with incomplete blood count recovery,” “refractory disease,” “partial response,” “disease progression” or “progressive disease,” “refractory disease,” “relapse” or “relapsed disease” each refer to assessments of disease state and response in subjects following treatment according to the methods disclosed herein.

As used herein, the term “transgene” refers to a nucleic acid molecule that encodes a polypeptide or RNA that is heterologous to the vector sequences flanking the coding sequence or is intended for transfer or has been transferred to a non-native cell or genomic locus.

As used herein, the terms “recombinant” or “engineered,” with respect to a protein, means having an altered amino acid sequence as a result of the application of genetic engineering techniques to nucleic acids that encode the protein and cells or organisms that express the protein. With respect to a nucleic acid, the term “recombinant” or “engineered” means having an altered nucleic acid sequence as a result of the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning technologies; transfection, transformation, and other gene transfer technologies; homologous recombination; site-directed mutagenesis; and gene fusion. In accordance with this definition, a protein having an amino acid sequence identical to a naturally-occurring protein, but produced by cloning and expression in a heterologous host, is not considered recombinant or engineered.

As used herein, the terms “exogenous” or “heterologous” in reference to a nucleotide sequence or amino acid sequence are intended to mean a sequence that is purely synthetic, that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.

As used herein, the term “endogenous” in reference to a nucleotide sequence or protein is intended to mean a sequence or protein that is naturally comprised within or expressed by a cell.

As used herein, the term “wild-type” refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in the allele population of the same type of gene, wherein a polypeptide encoded by the wild-type allele has its original functions. The term “wild-type” also refers to a polypeptide encoded by a wild-type allele. Wild-type alleles (i.e., polynucleotides) and polypeptides are distinguishable from mutant or variant alleles and polypeptides, which comprise one or more mutations and/or substitutions relative to the wildtype sequence(s). Whereas a wild-type allele or polypeptide can confer a normal phenotype in an organism, a mutant or variant allele or polypeptide can, in some instances, confer an altered phenotype. Wild-type nucleases are distinguishable from recombinant or non- naturally-occurring nucleases. The term “wild-type” can also refer to a cell, an organism, and/or a subject which possesses a wild-type allele of a particular gene, or a cell, an organism, and/or a subject used for comparative purposes.

As used herein, the term “genetically-modified” refers to a cell or organism in which, or in an ancestor of which, a genomic DNA sequence has been deliberately modified by recombinant technology. As used herein, the term “genetically-modified” encompasses the term “transgenic.”

As used herein, the term with respect to recombinant proteins, the term “modification” means any insertion, deletion, or substitution of an amino acid residue in the recombinant sequence relative to a reference sequence (e.g., a wild-type or a native sequence).

As used herein, the term “inactivation” or “inactivated” or “disrupted” or “disrupts” or “disrupts expression” or “disrupting a target sequence” refers to the introduction of a mutation (e.g., frameshift mutation) that interferes with the gene function and prevents expression and/or function of the polypeptide/expression product encoded thereby. For example, nuclease-mediated inactivation or disruption of a gene can result in the expression of a truncated protein and/or expression of a protein that does not retain its wild-type function. Additionally, introduction of a donor template into a gene can result in no expression of an encoded protein, expression of a truncated protein, and/or expression of a protein that does not retain its wild-type function.

As used herein, the term with respect to both amino acid sequences and nucleic acid sequences, the terms “percent identity,” “sequence identity,” “percentage similarity,” “sequence similarity” and the like refer to a measure of the degree of similarity of two sequences based upon an alignment of the sequences that maximizes similarity between aligned amino acid residues or nucleotides, and which is a function of the number of identical or similar residues or nucleotides, the number of total residues or nucleotides, and the presence and length of gaps in the sequence alignment. A variety of algorithms and computer programs are available for determining sequence similarity using standard parameters. As used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/), and are described in, for example, Altschul et al. (1990), J. Mol. Biol. 215:403-410; Gish and States (1993), Nature Genet. 3:266-272; Madden et al. (1996), Meth. Enzymol.266:131-141; Altschul et al. (1997), Nucleic Acids Res. 25:33 89-3402); Zhang et al. (2000), J. Comput. Biol. 7(l-2):203-14. As used herein, percent similarity of two amino acid sequences is the score based upon the following parameters for the BLASTp algorithm: word size=3; gap opening penalty=-l l; gap extension penalty=-l; and scoring matrix=BLOSUM62. As used herein, percent similarity of two nucleic acid sequences is the score based upon the following parameters for the BLASTn algorithm: word size=l l; gap opening penalty=-5; gap extension penalty=-2; match reward=l; and mismatch penalty=-3.

As used herein, the term “recombinant DNA construct,” “recombinant construct,” “expression cassette,” “expression construct,” “chimeric construct,” “construct,” and “recombinant DNA fragment” are used interchangeably herein and are single or doublestranded polynucleotides. A recombinant construct comprises an artificial combination of nucleic acid fragments, including, without limitation, regulatory and coding sequences that are not found together in nature. For example, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source and arranged in a manner different than that found in nature. Such a construct may be used by itself or may be used in conjunction with a vector.

As used herein, the term “a control” or “a control cell” refers to a cell that provides a reference point for measuring changes in genotype or phenotype of a genetically-modified cell. A control cell may comprise, for example: (a) a wild-type cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the genetically- modified cell; (b) a cell of the same genotype as the genetically-modified cell but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest); or, (c) a cell genetically identical to the genetically-modified cell but which is not exposed to conditions or stimuli or further genetic modifications that would induce expression of altered genotype or phenotype.

As used herein, the term “vector” or “recombinant DNA vector” may be a construct that includes a replication system and sequences that are capable of transcription and translation of a polypeptide-encoding sequence in a given host cell. If a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. Vectors can include, without limitation, plasmid vectors and recombinant AAV vectors, or any other vector known in the art suitable for delivering a gene to a target cell. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleotides or nucleic acid sequences of the invention. In some embodiments, a “vector” also refers to a virus (i.e., a viral vector). Viruses can include, without limitation retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses (AAVs).

As used herein, the term “inhibitory molecule” refers to any molecule (e.g., chemical compound, DNA, RNA) that reduces the expression of a target gene in a cell and levels of the encoded gene product as compared to a control cell (e.g., one which does not comprise or has not been introduced to the inhibitory molecule).

As used herein, the term “inhibitory nucleic acid molecule” refers to a nucleic acid molecule that can function as an inhibitory molecule by reducing the expression of a target gene or that encodes such an inhibitory molecule. A non-limiting example of an inhibitory nucleic acid molecule is an RNA interference (RNAi) molecule that reduces the expression of a target gene via RNA interference. As used herein, the term “RNA interference” or “RNAi” refers to a phenomenon in which the introduction of double- stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA- induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Pat. No. 6,506,559.

The term “siRNA” as used herein refers to small interfering RNA, also known as short interfering RNA or silencing RNA. siRNAs can be, for example, 18 to 30, 20 to 25, 21 to 23 or 21 nucleotide-long double-stranded RNA molecules. An “shRNA” as used herein is a short hairpin RNA, which is a sequence of RNA that makes a tight hairpin turn that can also be used to silence gene expression via RNA interference. shRNA can by operably linked to the U6 promoter for expression. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA. shRNA disclosed herein can comprise a sequence complementary to at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, or 23 nucleotides of the mRNA of a target protein.

As used herein, the term “miRNA” or “microRNA” or “miR” refers to mature microRNAs (miRNAs) that are endogenously encoded ~22 nt long RNAs that post- transcriptionally reduce the expression of target genes. miRNAs are found in plants, animals, and some viruses and are generally expressed in a highly tissue- or developmental- stagespecific fashion.

A "stem- loop structure" refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (loop portion), In some cases, the loop may also be very short and thereby not be recognized by Dicer, leading to Dicer- independent shRNAs (comparable to the endogenous miR0431). The term “hairpin” is also used herein to refer to stem-loop structures. The actual primary sequence of nucleotides within the stem-loop structure is not critical to the practice of the description as long as the secondary structure is present. As is known in the art, the secondary structure does not require exact base-pairing. Thus, the stem may include one or more base mismatches. Alternatively, the base-pairing may be exact (i.e., not include any mismatches).

As used herein, the terms “shRNAmiR” and “microRN A- adapted shRNA” refer to shRNA sequences embedded within a microRNA scaffold. A shRNAmiR molecule mimics naturally-occurring pri-miRNA molecules in that they comprise a hairpin flanked by sequences necessary for efficient processing and can be processed by the Drosha enzyme into pre-miRNAs, exported into the cytoplasm, and cleaved by Dicer, after which the mature miRNA can enter the RISC. The microRNA scaffold can be derived from naturally- occurring microRNA, pre-miRNAs, or pri-miRNAs or variants thereof. In some embodiments, the shRNA sequences which the shRNAmiR is based upon is of a different length from miRNAs (which are 22 nucleotides long) and the miRNA scaffold must therefore be modified in order to accommodate the longer or shorter shRNA sequence length.

As used herein, the term “microRNA flanking sequences” refers to nucleotide sequences comprising microRNA processing elements. MicroRNA processing elements are the minimal nucleic acid sequences which contribute to the production of mature microRNA from primary microRNA or precursor microRNA. Often these elements are located within a 40 nucleotide sequence that flanks a microRNA stem-loop structure. In some instances, the microRNA processing elements are found within a stretch of nucleotide sequences of between 5 and 4,000 nucleotides in length that flank a microRNA stem-loop structure. MicroRNA flanking sequences used in the shRNAmiR molecules can be naturally-occurring sequences flanking naturally-occurring microRNA or can be variants thereof. MicroRNA flanking sequences include miR scaffold domains and miR basal stem domains. shRNAmiR molecules used in the presently disclosed compositions and methods can comprise in the 5' to 3' direction: (a) a 5' miR scaffold domain; (b) a 5' miR basal stem domain; (c) a passenger strand; (d) a miR loop domain; (e) a guide strand; (f) a 3' miR basal stem domain; and (g) a 3' miR scaffold domain.

As used herein, the term “miR scaffold domain” as it relates to a shRNAmiR refers to a nucleotide sequence that can flank either the 5' or 3' end of a microRNA or shRNA in a shRNAmiR molecule and can be derived from a naturally-occurring microRNA flanking sequence or a variant thereof. In general, the miR basal stem domain sequence separates the shRNA sequence (passenger and guide strand, and miR loop domain) and the scaffold domains. The 5' miR scaffold domain can comprise a restriction enzyme (e.g., type IIS restriction enzyme) recognition sequence at or near its 3' end and the 3' miR scaffold domain can comprise a restriction enzyme recognition sequence at or near its 5' end, thus facilitating the insertion of a shRNA sequence. In some embodiments, the secondary structure of the miR scaffold domain is more important than the actual sequence thereof.

As used herein, the term “miR basal stem domain” as it relates to a shRNAmiR refers to sequences immediately flanking the passenger and guide strand sequences that comprise the base of the hairpin stem below the passenger: guide duplex. Thus, the 5' and 3' miR basal stem domains are complementary (fully or partially) in sequence to one another. In some embodiments, the 5' and 3' miR basal stem domains comprise sequences that when hybridized together, form two mismatch bubbles, each comprising one or two mismatched base pairs.

As used herein, the term “passenger strand” as it relates to a shRNAmiR refers to the sequence of the shRNAmiR, which is complementary (fully or partially) to the guide sequence.

As used herein, the term “guide strand” as it relates to a shRNAmiR refers to the sequence of the shRNAmiR that has complementarity (full or partial) with the target mRNA sequence for which a reduction in expression is desired.

As used herein, a “miR loop domain” as it relates to a shRNAmiR refers to the singlestranded loop sequence at one end of the passengerguide duplex of the shRNAmiR. The miR loop domain can be derived from a naturally-occurring pre-microRNA loop sequence or a variant thereof.

As used herein, the recitation of a numerical range for a variable is intended to convey that the present disclosure may be practiced with the variable equal to any of the values within that range. Thus, for a variable which is inherently discrete, the variable can be equal to any integer value within the numerical range, including the end-points of the range. Similarly, for a variable which is inherently continuous, the variable can be equal to any real value within the numerical range, including the end-points of the range. As an example, and without limitation, a variable which is described as having values between 0 and 2 can take the values 0, 1 or 2 if the variable is inherently discrete, and can take the values 0.0, 0.1, 0.01, 0.001, or any other real values =^0 and ^2 if the variable is inherently continuous.

2.1 Principle of the Invention

The present disclosure provides methods and compositions for protecting genetically- modified immune cells from the toxic effects of nucleoside analogs (e.g., fludarabine) by knocking down the gene deoxycytidine kinase (dCK), which metabolizes nucleoside analogs used for lymphodepletion regimens (e.g., fludarabine) from their prodrug form to an active form. As demonstrated herein, genetically-modified immune cells having reduced expression of dCK can be enriched by incubation of a cell population with a nucleoside analog such as fludarabine, thus, generating a population of nucleoside analog (e.g., fludarabine) resistant genetically-modified immune cells (e.g., CAR T cells). Genetically-modified immune cells (e.g., CAR T cells) having reduced expression of dCK may have greater persistence in vivo during immunotherapy when a nucleoside analog, such as fludarabine, is administered during lymphodepletion and in some embodiments, after administration of the genetically-modified immune cells.

2.2 Inhibitory Nucleic Acid Molecules

According to the presently disclosed methods, the genetically-modified human immune cells exhibit reduced expression of deoxy cytidine kinase (dCK). In some embodiments, the genetically-modified human immune cells having reduced expression of dCK exhibit greater resistance to nucleoside analogs compared to control cells that do not exhibit reduced expression of dCK.

In some embodiments, the genetically-modified human immune cells comprise an inhibitory molecule that is inhibitory against dCK, resulting in reduced expression of dCK. In some of these embodiments, the inhibitory molecule comprises an inhibitory nucleic acid molecule. In certain embodiments, the inhibitory nucleic acid molecule comprises or encodes an RNA interference (RNAi) molecule. In particular embodiments, the RNAi molecule is a short hairpin RNA (shRNA), small interfering RNA (siRNA), microRNA (miRNA), or a microRNA-adapted shRNA (shRNAmiR).

The RNAi molecule (e.g., shRNAmiR) may target any region of a dCK mRNA. Representative dCK mRNA and protein sequences are known in the art. A non-limiting example of a dCK mRNA sequence is NCBI Acc. No. NM_000788.3 and a dCK protein sequence is NCBI Acc. No. NP_000779.1.

In some of those embodiments wherein the expression of dCK is reduced by an inhibitory molecule (e.g., shRNAmiR), the expression of dCK is reduced by between 5% and about 95%, between 30% and 90%, between 50% and 85%, between 60% and 80%, between 65% and 75%, including but not limited to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or up to about 99% compared to a control cell (e.g., a cell not comprising an inhibitory molecule). Reduced expression of dCK can be measured by any method known in the art, including measuring the levels of dCK mRNA or protein or measuring the amount of dCK enzymatic activity (i.e., metabolization of nucleoside analogs from their prodrug form to an active form) or a downstream effect of reduced dCK expression, such as the effects of a nucleoside analog on the proliferation and survival of cells having reduced dCK expression as compared to control cells.

The shRNAmiR molecule used in the presently disclosed methods can comprise a microRNA scaffold in that the structure of the shRNAmiR molecule can mimic that of a naturally-occurring microRNA (or pri-miRNA or pre-miRNA) or a variant thereof. Sequences of microRNAs (and pri-miRNAs and pre-miRNAs) are known in the art. Nonlimiting examples of suitable miR scaffolds for the presently disclosed shRNAmiRs include miR-E, miR-30 (e.g., miR-30a), miR-15, miR-16, miR-155, miR-22, miR-103, and miR-107. In particular embodiments, the shRNAmiR used in the presently disclosed compositions and methods comprises a mir-E scaffold. The mir-E scaffold is a synthetically-derived variant of miR-30a and its genesis is described in International Publication No. WO 2014/117050, which is incorporated by reference in its entirety.

The shRNAmiR molecules useful in the presently disclosed methods can comprise the following domains in the 5' to 3' direction: (a) a 5' miR scaffold domain; (b) a 5' miR basal stem domain; (c) a passenger strand; (d) a miR loop domain; (e) a guide strand; (f) a 3' miR basal stem domain; and (g) a 3' miR scaffold domain. The miR scaffold domains and basal stem domains flank the miRNA stem-loop and are referred to herein as microRNA flanking sequences that comprise the microRNA processing elements (the minimal nucleic acid sequences which contribute to the production of mature microRNA from primary microRNA or precursor microRNA). Often these elements are located within a 40 nucleotide sequence that flanks a microRNA stem-loop structure. In some instances, the microRNA processing elements are found within a stretch of nucleotide sequences of between 5 and 4,000 nucleotides in length that flank a microRNA stem-loop structure.

In some embodiments, the miRNA flanking sequences are about 3 to about 4,000 nt in length and can be present on either or both the 5' and 3' ends of the shRNAmiR molecule. In other embodiments, the minimal length of the microRNA flanking sequence of the shRNAmiR molecule is about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 125, about 126, about 127, about 128, about 129, about 130, about 131, about 132, about 133, about 134, about 135, about 136, about 137, about 138, about 139, about 140, about 150, about 200, and any integer therein between. In other embodiments the maximal length of the microRNA flanking sequence of the shRNAmiR molecule is about 2,000, about 2,100, about 2,200, about 2,300, about 2,400, about 2,500, about 2,600, about 2,700, about 2,800, about 2,900, about 3,000, about 3,100, about 3,200, about 3,300, about 3,400, about 3,500, about 3,600, about 3,700, about 3,800, about 3,900, about 4,000, and any integer therein between.

The microRNA flanking sequences may be native microRNA flanking sequences or artificial microRNA flanking sequences. A native microRNA flanking sequence is a nucleotide sequence that is ordinarily comprised within naturally existing systems with microRNA sequences (i.e., these sequences are found within the genomic sequences surrounding the minimal microRNA hairpin in vivo). Artificial microRNA flanking sequences are nucleotides sequences that are not found to be flanking microRNA sequences in naturally existing systems. The artificial microRNA flanking sequences may be flanking sequences found naturally in the context of other microRNA sequences. Alternatively, they may be composed of minimal microRNA processing elements which are found within naturally occurring flanking sequences and inserted into other random nucleic acid sequences that do not naturally occur as flanking sequences or only partially occur as natural flanking sequences.

In some embodiments, the 5' miR scaffold domain is about 10 to about 150 nucleotides in length, including but not limited to about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, and about 150 nucleotides long. In some of these embodiments, the 5' miR scaffold domain is about 111 nucleotides in length. The 5' miR scaffold domain may comprise a 3' sequence that is a recognition sequence for a type IIS restriction enzyme. In some of these embodiments, the 5' miR scaffold domain comprises a Xhol recognition sequence on its 3' end. In particular embodiments, the 5' miR scaffold domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the sequence set forth as SEQ ID NO: 17. In certain embodiments, the 5' miR scaffold domain has the sequence set forth as SEQ ID NO: 17.

The 5' miR basal stem domain of the shRNAmiR can be about 5 to about 30 nucleotides in length in some embodiments, including but not limited to about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, and about 30 nucleotides long. In some of these embodiments, the 5' miR basal stem domain is about 20 nucleotides in length. In particular embodiments, the 5' miR basal stem domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the sequence set forth as SEQ ID NO: 18. In certain embodiments, the 5' miR basal stem domain has the sequence set forth as SEQ ID NO: 18.

The shRNAmiR molecules useful in the presently disclosed methods comprise a stem-loop structure, wherein the stem is comprised of the hybridized passenger and guide strands and the loop is single-stranded. The miR loop domain can be derived from a naturally-occurring pre-microRNA or pri-microRNA loop sequence or a variant thereof. In some embodiments, the miR loop domain has the sequence of a loop domain from any one of miR-30 (e.g., miR-30a), miR-15, miR-16, miR-155, miR-22, miR-103, and miR-107. In particular embodiments, the shRNAmiR comprises a miR-30a loop domain, the sequence of which is set forth as SEQ ID NO: 19.

In certain embodiments, the miR loop domain is about 5 to about 30 nucleotides in length, including but not limited to about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, and about 30 nucleotides long. In some of these embodiments, the miR loop domain is about 15 nucleotides in length. In particular embodiments, the miR loop domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the sequence set forth as SEQ ID NO: 19. In certain embodiments, the miR loop domain has the sequence set forth as SEQ ID NO: 19.

The 3' miR basal stem domain of the shRNAmiR can be about 5 to about 30 nucleotides in length in some embodiments, including but not limited to about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, and about 30 nucleotides long. In some of these embodiments, the 3' miR basal stem domain is about 18 nucleotides in length. In particular embodiments, the 3' miR basal stem domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the sequence set forth as SEQ ID NO: 20. In certain embodiments, the 3' miR basal stem domain has the sequence set forth as SEQ ID NO: 20.

In some embodiments, the 3' miR scaffold domain is about 50 to about 150 nucleotides in length, including but not limited to about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 nucleotides long. In some of these embodiments, the 3' miR scaffold domain is about 116 nucleotides in length. In particular embodiments, the 3' miR scaffold domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to the sequence set forth as SEQ ID NO: 21. In certain embodiments, the 3' miR scaffold domain has the sequence set forth as SEQ ID NO: 21.

The guide strand of the shRNAmiR is the sequence that targets the mRNA, leading to reduction in abundance of the protein encoded by the mRNA. After the guide strand binds to its target mRNA, RISC either degrades the target transcript and/or prevents the target transcript from being loaded into the ribsome for translation. The guide strand is of sufficient complementarity with the target mRNA in order to lead to reduced expression of the target mRNA. In some embodiments, the guide strand is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99% or 100% complementary to the target mRNA sequence. In certain embodiments, the guide strand hybridizes with the target mRNA within a coding sequence. The guide strand can comprise 1, 2, 3, 4, 5, or more mismatching nucleotides with the target mRNA sequence. In other embodiments, the guide strand hybridizes with the target mRNA in a non-coding region, such as a 5' or 3' untranslated region (UTR). In some embodiments, the guide strand is about 15 to about 25 nucleotides in length, including but not limited to about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, and about 25 nucleotides long. In some of these embodiments, the guide strand is about 22 nucleotides in length. In particular embodiments wherein the shRNA sequence from which the shRNAmiR is derived is less than 22 nucleotides in length, which is the length of most naturally-occurring microRNAs, an additional nucleotide is added to the shRNA sequence and in certain embodiments, this additional nucleotide is one that is complementary with the corresponding position within the target mRNA.

The passenger strand of the shRNAmiR is the sequence that is fully or partially complementary with the guide strand sequence. In some embodiments, the passenger strand is about 15 to about 25 nucleotides in length, including but not limited to about 15 to about 25 nucleotides in length, including but not limited to about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, and about 25 nucleotides long. In some of these embodiments, the passenger strand is about 22 nucleotides in length. The passenger strand can be at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99% or 100% complementary to the guide strand sequence. The passenger strand can comprise 1, 2, 3, 4, 5, or more mismatching nucleotides with the guide strand. In certain embodiments, however, the guide:passenger strand duplex does not comprise any mismatching nucleotides. In general, guide/passenger strand sequences should be selected that do not form any secondary structures within themselves. Further, the use of guide/passenger strand sequences that target sites within an mRNA that comprise singlenucleotide polymorphisms should be avoided. Guide/passenger strand sequences that are specific for the target mRNA are preferred to avoid any off-target effects (i.e., reduction in expression of non-target mRNAs).

In order to aid in the selection of suitable shRNAmiR guide/passenger strands, or sequences for other shRNAmiR domains, any program known in the art that models the predicted secondary structure of a RNA molecule can be used, including but not limited to Mfold, RNAfold, and UNAFold. Any program known in the art that can predict the efficiency of a shRNA or miRNA guide/passenger sequence to target a particular mRNA can be used to select suitable guide/passenger strand sequences, including but not limited to those disclosed in Agarwal et al. (2015) eLife 4:e05005; and Knott et al. (2014) Mol Cell 56(6):796-807, each of which is incorporated herein in its entirety. shRNAmiR molecules that target dCK may comprise any passenger and corresponding guide sequence that is complementary (fully or partially) to a sequence within the dCK gene. In some embodiments, the passenger and guide sequence of the shRNAmiR comprise the sequences set forth as SEQ ID NO: 7 and 8, respectively (e.g., dCK 72136 shRNAmiR). In other embodiments, the passenger and guide sequence of the shRNAmiR comprise the sequences set forth as SEQ ID NO: 9 and 10, respectively (e.g., dCK 72137 shRNAmiR). In other embodiments, the passenger and guide sequence of the shRNAmiR comprise the sequences set forth as SEQ ID NO: 11 and 12, respectively (e.g., dCK 72138 shRNAmiR). In other embodiments, the passenger and guide sequence of the shRNAmiR comprise the sequences set forth as SEQ ID NO: 13 and 14, respectively (e.g., dCK 72139 shRNAmiR). In other embodiments, the passenger and guide sequence of the shRNAmiR comprise the sequences set forth as SEQ ID NO: 15 and 16, respectively (e.g., dCK 72140 shRNAmiR).

The dCK-targeted shRNAmiR may comprise a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the nucleic acid sequence set forth in any one of SEQ ID NOs: 2-6. In particular embodiments, the shRNAmiR comprises the sequence set forth in SEQ ID NO: 2.

In some of the embodiments wherein the genetically-modified immune cell comprises an inhibitory molecule that reduces the expression of dCK, the genetically-modified immune cell is less susceptible (i.e., resistant) to the effects of a nucleoside analog (e.g., fludarabine) on cell proliferation and survival. In some embodiments, genetically-modified immune cells having reduced expression of dCK can be enriched by incubation of a cell population with a purine nucleoside analog such as fludarabine. In some embodiments, genetically-modified immune cells (e.g., CAR T cells) having reduced expression of dCK may have greater persistence in vivo during immunotherapy when a purine nucleoside analog such as fludarabine is administered during the course of therapy. In some embodiments, the genetically-modified immune cell comprising an inhibitory molecule that reduces the expression of dCK exhibits resistance to a nucleoside analog (e.g., fludarabine), including but not limited to at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% greater cell survival, cell expansion, and target cell killing in the presence of a nucleoside analog compared to a control cell (e.g., a cell not comprising the inhibitory molecule that reduces the expression of dCK).

2.3 Lymphodepletion Regimen In some embodiments of the presently disclosed methods, the methods comprise a lymphodepletion regimen wherein one or more effective doses of one or more lymphodepletion agents are administered to the subject in order to reduce the number of endogenous lymphocytes prior to administration of the pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are genetically-modified human immune cells. According to the presently disclosed methods, the lymphodepletion regimen comprises a nucleoside analog (e.g., fludarabine), which is a chemotherapeutic lymphodepletion agent. The lymphodepletion regimen used in the presently disclosed methods can comprise one or more additional lymphodepletion agents such as biological lymphodepletion agents, chemotherapeutic lymphodepletion agents, or a combination thereof.

A biological lymphodepletion agent can be, for example, any biological material, such an antibody, antibody fragment, antibody conjugate, or the like, that can be administered as part of a lymphodepletion regimen to reduce endogenous lymphocytes in the subject for immunotherapy. Such biological lymphodepletion agents can include, for example, a monoclonal antibody, or a fragment thereof. In some examples, the biological lymphodepletion agent has specificity for a T cell antigen; i.e., an antigen expressed on the cell surface of T cells. Examples of such antigens include, without limitation, CD52 and CD3. In a particular example, the biological lymphodepletion agent is an antibody, such as a monoclonal antibody, having specificity for CD52. Such antibodies can include, for example, alemtuzumab (i.e., CAMPATH), ALLO-647 (Allogene Therapeutics, San Francisco, CA), derivatives thereof, which bind CD52, or any other CD52 antibody. In another particular example, the biological lymphodepletion agent is an antibody, such as a monoclonal antibody, having specificity for CD3. In some cases, an anti-CD3 antibody can be muromonab-CD3 (Orthoclone OKT3™), otelixizumab, teplizumab, foralumab, visilizumab, or derivatives thereof, which have specificity for CD3.

In some embodiemnts, lymphodepletion regimens of the invention include the administration of one or more chemotherapeutic lymphodepletion agents. Pre-treatment or pre-conditioning patients prior to cell therapies with one or more chemotherapeutic lymphodepletion agents improves the efficacy of the cellular therapy by reducing the number of endogenous host lymphocytes in the subject, thereby providing a more optimal environment for administered cells to proliferate once administered to the subject. An effective dose of one or more chemotherapeutic lymphodepletion agents can result in the reduction of one or more endogenous lymphocytes (e.g., B cells, T cells, and/or NK cells) in the subject by at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or up to 100% relative to a control; e.g., relative to a starting amount in the subject undergoing treatment, relative to a pre-determined threshold, or relative to an untreated subject.

In some embodiments, 1, 2, 3, 4, or more chemotherapeutic lymphodepletion agents may be included in the lymphodepletion regimen.

Chemotherapeutic lymphodepletion agents can refer to non-biological materials, such as small molecules, that can be administered as part of a lymphodepletion regimen to reduce endogenous lymphocytes in the subject for immunotherapy. In some examples, the chemotherapeutic lymphodepleting agent can be lymphodepleting but non-myeloablative.

Chemotherapeutic lymphodepletion agents can include those known in the art including, without limitation, nucleoside analog (e.g., fludarabinejs (such as fludarabine, pentostatin, azathioprine, mercaptopurine such as 6-mercaptopurine, clofarabine, cladribine, and thiopurines such as thioguanine), and compounds capable of inducing interstrand crosslinks within DNA (such as cisplatin, mitomycin C, carmustine, psoralen or nitrogen mustard- derived alkylating agents like cyclophosphamide, ifosfamide, chlorambucil, uramustine, melphalan, and bendamustine). Other non-limiting examples of chemotherapeutic lymphodepletion agents useful in the presently disclosed methods include daunorubicin, L- asparaginase, methotrexate, prednisone, dexamethasone, and nelarabine. In some embodiments, the lymphodepletion regimen comprises one or more chemotherapeutic lymphodepletion agents, wherein the one or more chemotherapeutic lymphodepletion agents comprises fludarabine. In some embodiments, the one or more chemotherapeutic lymphodepletion agents further comprises cyclophosphamide.

The lymphodepletion regimen administered during the method of the invention can be administered in an amount effective (i.e., an effective dose) to deplete or reduce the quantity of endogenous lymphocytes in the subject, for example, by 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, relative to a control, e.g., relative to a starting amount in the subject undergoing treatment, relative to a pre-determined threshold, or relative to an untreated subject, prior to administration of the pharmaceutical composition. The reduction in lymphocyte count can be monitored using conventional techniques known in the art, such as by flow cytometry analysis of cells expressing characteristic lymphocyte cell surface antigens in a blood sample withdrawn from the subject at varying intervals during treatment with the antibody. According to some embodiments, when the concentration of lymphocytes has reached a minimum value in response to the lymphodepletion regimen, the physician may conclude the lymphodepletion therapy and may begin preparing the subject for administration of the pharmaceutical composition.

In various embodiments, the one or more chemotherapeutic lymphodepletion agents can be administered one day to one month (e.g., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, or 30 days) prior to administration of the pharmaceutical compositions described herein. In some embodiments, one or more chemotherapeutic lymphodepletion agents are administered to the subject two or more days prior to administration of the pharmaceutical composition. In some embodiments, one or more chemotherapeutic lymphodepletion agents are administered to the subject within seven days prior to administration of the pharmaceutical composition. In certain embodiments, administration of one or more chemotherapeutic lymphodepletion agents ends at least one day, at least two days, or at least three days prior to administration of the pharmaceutical composition.

In some embodiments, a chemotherapeutic lymphodepletion agent is administered as a single dose per day on each of eight consecutive days, as a single dose per day on each of seven consecutive days, as a single dose per day on each of six consecutive days, as a single dose per day on each of five consecutive days, as a single dose per day on each of four consecutive days, as a single dose per day on each of three consecutive days, as a single dose per day on each of two consecutive days, or as a single dose on one day, prior to administration of the pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are genetically-modified human immune cells. In some embodiments, a chemotherapeutic lymphodepletion agent is administered as a single dose per day for at least one day, or for multiple days, within seven days prior to administration of the pharmaceutical composition.

In some embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) at a dose between about 1 mg/m²/day and about 60 mg/m²/day. In some of these embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) at a dose between about 10 mg/m²/day to about 40 mg/m²/day. In certain embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) at a dose between about 20 mg/m²/day and 40 mg/m²/day. In some of these embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) at a dose of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 45, about 50, about 55, or about 60 mg/m²/day. In particular embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) at a dose of about 30 mg/m²/day.

In certain embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 5 days and ending 3 days prior to administration of the pharmaceutical composition, starting 4 days and ending 2 day prior to administration of the pharmaceutical composition, starting 3 days and ending 1 day prior to administration of the pharmaceutical composition, starting 2 days before and ending the day of administration of the pharmaceutical composition, starting 1 day before and ending 1 day after administration of the pharmaceutical composition, starting 5 days and ending 4 days prior to administration of the pharmaceutical composition, starting 4 days and ending 3 days prior to administration of the pharmaceutical composition, starting 3 days and ending 2 days prior to administration of the pharmaceutical composition, starting 2 days and ending 1 day prior to administration of the pharmaceutical composition, starting 1 day before and ending the day of administration of the pharmaceutical composition, starting the day of administration of the pharmaceutical composition and ending the day after administration of the pharmaceutical composition, starting 2 days and ending 4 days after administration of the pharmaceutical composition, starting 3 days and ending 5 days after administration of the pharmaceutical composition, starting 4 days and ending 6 days after administration of the pharmaceutical composition, or starting 5 days and ending 7 days after administration of the pharmaceutical composition.

In some of these embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 5 days prior to administration of the pharmaceutical composition and ending 4 days, 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition, ending the day of administration of the pharmaceutical composition, or ending 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 4 days prior to administration of the pharmaceutical composition and ending 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition, ending the day of administration of the pharmaceutical composition, or ending 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In still other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 3 days prior to administration of the pharmaceutical composition and ending 2 days or 1 day prior to administration of the pharmaceutical composition, ending the day of administration of the pharmaceutical composition, or ending 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In yet other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 2 days prior to administration of the pharmaceutical composition and ending 1 day prior to administration of the pharmaceutical composition, ending the day of administration of the pharmaceutical composition, or ending 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 1 day prior to administration of the pharmaceutical composition and ending the day of administration of the pharmaceutical composition, or ending 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In still other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting the day of administration of the pharmaceutical composition and ending 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In yet other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 1 day after administration of the pharmaceutical composition and ending 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 2 days after administration of the pharmaceutical composition and ending 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 3 days after administration of the pharmaceutical composition and ending 4 days, 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In still other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 4 days after administration of the pharmaceutical composition and ending 5 days, 6 days, or 7 days after administration of the pharmaceutical composition. In yet other embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 5 days after administration of the pharmaceutical composition and ending 6 days or 7 days after administration of the pharmaceutical composition. In certain embodiments, the lymphodepletion regimen comprises administering a nucleoside analog (e.g., fludarabine) once daily starting 6 days after administration of the pharmaceutical composition and ending 7 days after administration of the pharmaceutical composition.

In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily to the subject. In some of these embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily to the subject after administration of the pharmaceutical composition. In certain embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily to the subject after administration of the pharmaceutical composition for a total of 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 2 days and ending 4 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 3 days and ending 5 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 4 days and ending 6 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 5 days and ending 7 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 6 days and ending 8 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 7 days and ending 9 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 8 days and ending 10 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 9 days and ending 11 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 10 days and ending 12 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 11 days and ending 13 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 12 days and ending 14 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 13 days and ending 15 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 14 days and ending 16 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 2 days and ending 3 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 3 days and ending 4 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 4 days and ending 5 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 5 days and ending 6 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 6 days and ending 7 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 7 days and ending 8 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 8 days and ending 9 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 9 days and ending 10 days after administration of the pharmaceutical composition.

In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 10 days and ending 11 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 11 days and ending 12 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 12 days and ending 13 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 13 days and ending 14 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once daily starting 14 days and ending 15 days after administration of the pharmaceutical composition. In some of these embodiments, the nucleoside analog (e.g., fludarabine) is readministered to the subject once daily starting 2 days and ending 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are genetically-modified human immune cells. In other embodiments, the nucleoside analog (e.g., fludarabine) is readministered to the subject once daily starting 3 days and ending 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In still other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 4 days and ending 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In yet other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 5 days and ending 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 6 days and ending 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In still other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 7 days and ending 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In yet other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 8 days and ending 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 9 days and ending 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 10 days and ending 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In still other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 11 days and ending 12 days, 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In yet other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 12 days and ending 13 days, 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In certain embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 13 days and ending 14 days, 15 days, or 16 days after administration of the pharmaceutical composition. In particular embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 14 days and ending 15 days or 16 days after administration of the pharmaceutical composition. In other embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject once daily starting 15 days and ending 16 days after administration of the pharmaceutical composition.

In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered once to the subject 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days after administration of the pharmaceutical composition comprising a population of human immune cells, wherein a plurality of the human immune cells are genetically-modified human immune cells.

In some embodiments, the nucleoside analog (e.g., fludarabine) is re-administered to the subject at a dose between about 1 mg/m²/day and about 60 mg/m²/day. In some of these embodiments, the nucleoside analog (e.g., fludarabine) is re-administered at a dose between about 10 mg/m²/day to about 40 mg/m²/day. In certain embodiments, the nucleoside analog (e.g., fludarabine) is re-administered at a dose between about 20 mg/m²/day and 40 mg/m²/day. In some of these embodiments, the nucleoside analog (e.g., fludarabine) is readministered at a dose of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 45, about 50, about 55, or about 60 mg/m²/day. In particular embodiments, the nucleoside analog (e.g., fludarabine) is readministered at a dose of about 30 mg/m²/day.

In some embodiments, the lymphodepletion regimen comprises administering one or more effective doses of a nucleoside analog (e.g., fludarabine) (e.g., fludarabine) and a compound capable of inducing interstrand cross-links within DNA (e.g., cyclophosphamide). Thus, in some embodiments, the lymphodepletion regimen further comprises administering cyclophosphamide. In certain embodiments, cyclophosphamide is administered to the subject at a dose of about 100 to about 2000 mg/m²/day, about 200 to about 1800 mg/m²/day, about 300 to about 1700 mg/m²/day, about 400 to about 1500 mg/m²/day, or about 500 to about 1000 mg/m²/day. In some of these embodiments, the lymphodepletion regimen comprises administering cyclophosphamide at a dose of about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600, about 1700, about 1800, about 1900, or about 2000 mg/m²/day. In particular embodiments, the lymphodepletion regimen comprises administering cyclophosphamide at a dose of about 500 mg/m²/day.

In certain embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 6 days and ending 4 days prior to administration of the pharmaceutical composition, starting 5 days and ending 3 days prior to administration of the pharmaceutical composition, or starting 4 days and ending 2 days prior to administration of the pharmaceutical composition. In some of these embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 8 days prior to administration of the pharmaceutical composition and ending 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition. In other embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 7 days prior to administration of the pharmaceutical composition and ending 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition. In still other embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 6 days prior to administration of the pharmaceutical composition and ending 5 days, 4 days, 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition. In yet other embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 5 days prior to administration of the pharmaceutical composition and ending 4 days, 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition. In other embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 4 days prior to administration of the pharmaceutical composition and ending 3 days, 2 days, or 1 day prior to administration of the pharmaceutical composition. In still other embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 3 days prior to administration of the pharmaceutical composition and ending 2 days or 1 day prior to administration of the pharmaceutical composition. In yet other embodiments, the lymphodepletion regimen comprises administering cyclophosphamide once daily starting 2 days prior to administration of the pharmaceutical composition and ending 1 day prior to administration of the pharmaceutical composition. The one or more chemotherapeutic lymphodepletion agents can be administered to the subject using any acceptable route of administration. In certain embodiments, the nucleoside analog is administered to the subject intravenously. In some embodiments, the alkylating agent (e.g., cyclophosphamide) is administered to the subject orally or intravenously.

In some embodiments, the lymphodepletion regimen does not comprise administering an effective dose of a biological lymphodepletion agent. In some embodiments, the lymphodepletion regimen does not comprise administering a biological lymphodepletion agent. Non-limiting examples of a biological lymphodepletion agent include monoclonal antibodies or fragments thereof. Such monoclonal antibodies or fragments thereof can have specificity for a T cell antigen. In some embodiments, the monoclonal antibody or fragment thereof is an anti-CD52 monoclonal antibody or fragment thereof, or an anti-CD3 antibody or fragment thereof. In certain embodiments, the monoclonal antibody is alemtuzumab or ALLO-647. In some embodiments, the lymphodepletion regimen includes administration of a biological lymphodepletion agent in an amount no greater than 1.0 mg/kg during the 7 day period preceding administration of the pharmaceutical composition. In some embodiments, the lymphodepletion regimen includes administration of a biological lymphodepletion agent in an amount no greater than 0.75 mg/kg, 0.5 mg/kg, 0.25 mg/kg, or 0.1 mg/kg during the 7 day period preceding administration of the pharmaceutical composition. In certain embodiments, the lymphodepletion regimen includes administration of a biological lymphodepletion agent in an amount no greater than 0.1 mg/kg during the 7 day period preceding administration of the pharmaceutical composition. In some examples, the lymphodepletion regimen includes no more than a minimal effective dose of a biological lymphodepletion agent.

2.4 Human Immune Cells and Populations of Genetically-Modified Human Immune Cells The invention provides methods that utilize genetically-modified human immune cells and populations thereof and provides methods for producing the same. In some embodiments, the genetically-modified human immune cells used in the presently disclosed methods are human immune cells. In some embodiments, the immune cells are T cells, or cells derived therefrom. In other embodiments, the immune cells are natural killer (NK) cells, or cells derived therefrom. In still other embodiments, the immune cells are B cells, or cells derived therefrom. In yet other embodiments, the immune cells are monocyte or macrophage cells or cells derived therefrom. Immune cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments of the present disclosure, any number of T cell lines, NK cell lines, B cell lines, monocyte cells lines, or macrophage cell lines available in the art may be used. In some embodiments of the present disclosure, immune cells are obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis. In some embodiments, the human immune cells utilized in the presently disclosed methods are not derived from the subject which is administered the pharmaceutical compositions disclosed herein. In further examples, immune cells useful for the methods can be derived from induced pluripotent stem cells (iPSCs) that have been differentiated into immune cells.

The genetically-modified human immune cells used in the presently disclosed methods comprise a cell surface engineered antigen receptor. Such engineered antigen receptors include but are not limited to chimeric antigen receptors (CAR)s and exogenous T cell receptors (TCR)s. Generally, a CAR utilized in the presently disclosed methods will comprise at least an extracellular domain, a transmembrane domain, and an intracellular domain. In some embodiments, the extracellular domain comprises a target- specific binding element otherwise referred to as an extracellular ligand-binding domain or moiety. In some embodiments, the intracellular domain, or cytoplasmic domain, comprises at least one costimulatory domain and one or more signaling domains.

Thus, a CAR or exogenous TCR useful in the invention comprises an extracellular ligand-binding domain. The choice of ligand-binding domain depends upon the type and number of ligands that define the surface of a target cell. For example, the ligand-binding domain may be chosen to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state. Thus, some examples of cell surface markers that may act as ligands for the ligand-binding domain in a CAR or exogenous TCR can include those associated with viruses, bacterial and parasitic infections, autoimmune disease, and cancer cells. In some embodiments, a CAR or exogenous TCR is engineered to target a cancer-specific antigen of interest by way of engineering a desired ligand-binding moiety that specifically binds to an antigen on a cancer (i.e., tumor) cell. In the context of the present disclosure, “cancer antigen,” tumor antigen,” “cancer- specific antigen,” or “tumor- specific antigen” refer to antigens that are common to specific hyperproliferative disorders such as cancer. In some embodiments, the extracellular ligand-binding domain of the CAR or exogenous TCR is specific for any antigen or epitope of interest, particularly any cancer antigen or epitope of interest. As non-limiting examples, in some embodiments the antigen of the target is a tumor-associated surface antigen, such as ErbB2 (HER2/neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), CD19, CD20, CD22, CD30, CD40, CD79B, IL1RAP, glypican 3 (GPC3), CLL-1, disialoganglioside GD2, ductal- epithelial mucine, gp36, TAG-72, glycosphingolipids, glioma-associated antigen, B-human chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE- 1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut hsp70-2, M-CSF, prostase, prostase specific antigen (PSA), PAP, NY-ESO-1, EAGA-la, p53, prostein, PSMA, surviving and telomerase, prostate-carcinoma tumor antigen- 1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, insulin growth factor (IGFl)-l, IGF-II, IGFI receptor, mesothelin, a major histocompatibility complex (MHC) molecule presenting a tumor- specific peptide epitope, 5T4, ROR1, Nkp30, NKG2D, tumor stromal antigens, the extra domain A (EDA) and extra domain B (EDB) of fibronectin and the Al domain of tenascin-C (TnC Al) and fibroblast associated protein (fap); a lineagespecific or tissue specific antigen such as CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD38, CD123, CD133, CD138, CTLA-4, B7- 1 (CD80), B7-2 (CD86), endoglin, a major histocompatibility complex (MHC) molecule, BCMA (CD269, TNFRSF 17), CS1, or a virusspecific surface antigen such as an HIV-specific antigen (such as HIV gpl20); an EBV- specific antigen, a CMV-specific antigen, a HPV-specific antigen such as the E6 or E7 oncoproteins (E7 oncoprotein- specific, HLA-A*02:01), a Lasse Virus-specific antigen, an Influenza Virus -specific antigen, as well as any derivate or variant of these surface markers.

In some examples, the extracellular ligand-binding domain or moiety is an antibody, or antibody fragment. An antibody fragment can, for example, be at least one portion of an antibody, that retains the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), a Fd fragment consisting of the VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either VL or VH), camelid VHH domains, multi- specific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody. An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide minibodies).

The extracellular ligand-binding domain of a chimeric antigen receptor or exogenous TCR can also comprise an autoantigen (see, Payne et al. (2016), Science 353 (6295): 179- 184), that can be recognized by autoantigen-specific B cell receptors on B lymphocytes, thus directing genetically-modified human immune cells to specifically target and kill autoreactive B lymphocytes in antibody-mediated autoimmune diseases. Such CARs can be referred to as chimeric autoantibody receptors (CAARs), and their use is encompassed by the invention. The extracellular ligand-binding domain of a chimeric antigen receptor or exogenous TCR can also comprise a naturally-occurring ligand for an antigen of interest, or a fragment of a naturally-occurring ligand which retains the ability to bind the antigen of interest.

In certain embodiments, the ligand-binding domain of the CAR or exogenous TCR is an scFv. In some such embodiments, the scFv comprises a heavy chain variable (VH) domain and a light chain variable (VL) domain from a monoclonal antibody having specificity for a cancer cell antigen. In some examples, the scFv comprises a VH domain and a VL domain obtained from a CD19-specific antibody. In some examples, the scFv comprises a VH domain and a VL domain obtained from a CD20-specific antibody. In some examples, the scFv comprises a VH domain and a VL domain obtained from a BCMA-specific antibody.

A CAR can comprise a transmembrane domain which links the extracellular ligandbinding domain with the intracellular signaling and co- stimulatory domains via a hinge region or spacer sequence. The transmembrane domain can be derived from any membranebound or transmembrane protein. For example, the transmembrane polypeptide can be a subunit of the T-cell receptor (e.g., an a, p, y or polypeptide constituting CD3 complex), IL2 receptor p55 (a chain), p75 (P chain) or y chain, subunit chain of Fc receptors (e.g., Fey receptor III) or CD proteins such as the CD8 alpha chain. Alternatively, the transmembrane domain can be synthetic and can comprise predominantly hydrophobic residues such as leucine and valine.

The hinge region refers to any oligo or polypeptide that functions to link the transmembrane domain to the extracellular ligand-binding domain. For example, a hinge region may comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. Hinge regions may be derived from all or part of naturally occurring molecules, such as from all or part of the extracellular region of CD8, CD4 or CD28, or from all or part of an antibody constant region. Alternatively, the hinge region may be a synthetic sequence that corresponds to a naturally occurring hinge sequence or may be an entirely synthetic hinge sequence. In particular examples, a hinge domain can comprise a part of a human CD8 alpha chain, FcyRllla receptor or IgGl.

Intracellular signaling domains of a CAR are responsible for activation of at least one of the normal effector functions of the cell in which the CAR has been placed and/or activation of proliferative and cell survival pathways. The term “effector function” refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. The intracellular signaling domain can include one or more cytoplasmic signaling domains that transmit an activation signal to the T cell following antigen binding.

The intracellular stimulatory domain can also include one or more intracellular costimulatory domains that transmit a proliferative and/or cell- survival signal after ligand binding. In some cases, the co- stimulatory domain can comprise one or more TRAF-binding domains. Such intracellular co- stimulatory domains can be any of those known in the art and can include, without limitation, those co-stimulatory domains disclosed in WO 2018/067697. Further examples of co-stimulatory domains can include 4-1BB (CD137), CD27, CD28, CD8, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, or any combination thereof. In a particular embodiment, the co-stimulatory domain is an N6 domain. In another particular embodiment, the co-stimulatory domain is a 4- IBB co- stimulatory domain.

In other embodiments, the genetically-modified human immune cell comprises a nucleic acid sequence encoding an exogenous TCR. Such exogenous TCRs can comprise alpha and beta chains or, alternatively, may comprise gamma and delta chains. Exogenous TCRs useful in the invention may have specificity to any antigen or epitope of interest. In some examples, the extracellular ligand-binding domain of an exogenous TCR can comprise an antibody or antibody fragment, such as an scFv, fused to one of the TCR complex subunits.

The CARs or exogenous TCRs described herein can have, for example, specificity for cancer cell antigens. Such cancers can include, without limitation, carcinoma, lymphoma, sarcoma, blastomas, leukemia, cancers of B cell origin, breast cancer, gastric cancer, neuroblastoma, osteosarcoma, lung cancer, melanoma, prostate cancer, colon cancer, renal cell carcinoma, ovarian cancer, rhabdomyosarcoma, leukemia, and Hodgkin lymphoma. In specific embodiments, cancers and disorders include but are not limited to pre-B ALL (pediatric indication), adult ALL, mantle cell lymphoma, diffuse large B cell lymphoma, salvage post allogenic bone marrow transplantation, and the like. These cancers can be treated using a combination of CARs that target, for example, CD 19, CD20, CD22, and/or ROR1. In some non-limiting examples, a genetically-modified human immune cell or population thereof of the present disclosure targets carcinomas, lymphomas, sarcomas, melanomas, blastomas, leukemias, and germ cell tumors, including but not limited to cancers of B-cell origin, neuroblastoma, osteosarcoma, prostate cancer, renal cell carcinoma, liver cancer, gastric cancer, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, breast cancer, lung cancer, cutaneous or intraocular malignant melanoma, renal cancer, uterine cancer, ovarian cancer, colorectal cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, non-Hodgkin lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, environmentally induced cancers including those induced by asbestos, multiple myeloma, Hodgkin lymphoma, non-Hodgkin lymphomas, acute myeloid lymphoma, chronic myelogenous leukemia, chronic lymphoid leukemia, immunoblastic large cell lymphoma, acute lymphoblastic leukemia, mycosis fungoides, anaplastic large cell lymphoma, and T-cell lymphoma, and any combinations of said cancers. In certain embodiments, cancers of B-cell origin include, without limitation, B -lineage acute lymphoblastic leukemia, B-cell chronic lymphocytic leukemia, B-cell lymphoma, diffuse large B cell lymphoma, pre-B ALL (pediatric indication), mantle cell lymphoma, follicular lymphoma, marginal zone lymphoma, Burkitt’s lymphoma, multiple myeloma, and B-cell non-Hodgkin lymphoma. In some examples, cancers can include, without limitation, cancers of B cell origin or multiple myeloma. In some examples, the cancer of B cell origin is acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), or nonHodgkin lymphoma (NHL). In some examples, the cancer of B cell origin is mantle cell lymphoma (MCL) or diffuse large B cell lymphoma (DLBCL).

In some embodiments, genetically-modified human immune cells useful in the presently disclosed methods comprise an inactivated TCR alpha gene and/or an inactivated TCR beta gene. Inactivation of the TCR alpha gene and/or TCR beta gene to generate the genetically-modified human immune cells used in the present disclosure occurs in at least one or both alleles where the TCR alpha gene and/or TCR beta gene is being expressed. Accordingly, inactivation of one or both genes prevents expression of the endogenous TCR alpha chain or the endogenous TCR beta chain protein. Expression of these proteins is required for assembly of the endogenous alpha/beta TCR on the cell surface. Thus, inactivation of the TCR alpha gene and/or the TCR beta gene results in genetically-modified human immune cells that have no detectable cell surface expression of the endogenous alpha/beta TCR. The endogenous alpha/beta TCR incorporates CD3. Therefore, cells with an inactivated TCR alpha gene and/or TCR beta chain can have no detectable cell surface expression of CD3. In particular embodiments, the inactivated gene is a TCR alpha constant region (TRAC) gene.

In some examples, the TCR alpha gene, the TRAC gene, the TCR beta gene, or the TRBC gene is inactivated by insertion of a transgene encoding the CAR or exogenous TCR and/or an inhibitory nucleic acid sequence encoding an inhibitory molecule. Insertion of the CAR or exogenous TCR transgene and/or inhibitory nucleic acid sequence disrupts expression of the endogenous TCR alpha chain or TCR beta chain and, therefore, prevents assembly of an endogenous alpha/beta TCR on the T cell surface. In some examples, the CAR or exogenous TCR transgene and/or inhibitory nucleic acid sequence is inserted into the TRAC gene. In a particular example, a CAR or exogenous TCR transgene and/or inhibitory nucleic acid sequence is inserted into the TRAC gene at an engineered meganuclease recognition sequence comprising SEQ ID NO: 1. In particular examples, the CAR or exogenous TCR transgene and/or inhibitory nucleic acid sequence is inserted into SEQ ID NO: 1 between nucleotide positions 13 and 14. Human immune cells used in the present disclosure may require activation prior to introduction of a nuclease and/or an exogenous sequence of interest to generate CAR T cells. For example, human immune cells can be contacted with anti-CD3 and anti-CD28 antibodies that are soluble or conjugated to a support (e.g., beads) for a period of time sufficient to activate the cells.

Immune cells used in the invention can be further modified to express one or more inducible suicide genes, the induction of which provokes cell death and allows for selective destruction of the cells in vitro or in vivo. In some examples, a suicide gene can encode a cytotoxic polypeptide, a polypeptide that has the ability to convert a non-toxic pro-drug into a cytotoxic drug, and/or a polypeptide that activates a cytotoxic gene pathway within the cell. That is, a suicide gene is a nucleic acid that encodes a product that causes cell death by itself or in the presence of other compounds. A representative example of such a suicide gene is one that encodes thymidine kinase of herpes simplex virus. Additional examples are genes that encode thymidine kinase of varicella zoster virus and the bacterial gene cytosine deaminase that can convert 5-fluorocytosine to the highly toxic compound 5- fluorouracil. Suicide genes also include as non-limiting examples genes that encode caspase- 9, caspase-8, or cytosine deaminase. In some examples, caspase-9 can be activated using a specific chemical inducer of dimerization (CID). A suicide gene can also encode a polypeptide that is expressed at the surface of the cell that makes the cells sensitive to therapeutic and/or cytotoxic monoclonal antibodies. In further examples, a suicide gene can encode recombinant antigenic polypeptide comprising an antigenic motif recognized by the anti-CD20 mAb Rituximab and an epitope that allows for selection of cells expressing the suicide gene. See, for example, the RQR8 polypeptide described in WO2013153391, which comprises two Rituximab-binding epitopes and a QBEndlO-binding epitope. For such a gene, Rituximab can be administered to a subject to induce cell depletion when needed. In further examples, a suicide gene may include a QBEndlO-binding epitope expressed in combination with a truncated EGFR polypeptide.

The invention utilizes a population of human immune cells that includes a plurality of genetically-modified human immune cells expressing a cell surface CAR or exogenous TCR. In various embodiments of the invention, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least

60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least

95%, at least 96%, at least 97%, at least 98%, at least 99%, or up to 100%, of cells in the population are a genetically-modified human immune cell as described herein. In a particular example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or up to 100%, of cells in the population are genetically-modified human immune cells that express a CAR or exogenous TCR and have an inactivated TCR alpha and/or beta gene. In particular embodiments, between about 20% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 30% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 40% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 50% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 60% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 70% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 80% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 90% to about 99% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 50% to about 80% of the human immune cells in the population are genetically-modified human immune cells. In particular embodiments, between about 60% to about 70% of the human immune cells in the population are genetically-modified human immune cells.

2.5 Methods for Genetically Modifying Human Immune Cells

The present disclosure uses human immune cells, or populations of human immune cells comprising a plurality of genetically-modified human immune cells that have been modified to express a CAR or an exogenous TCR and to reduce the expression of dCK. Such human immune cells can be modified in a number of ways in order to introduce a transgene encoding a CAR or exogenous TCR and/or an inhibitory nucleic acid sequence encoding an inhibitory molecule into the genome of the cell, such that the CAR or exogenous TCR, and/or inhibitory nucleic acid sequence is expressed by the cell. For example, a transgene encoding a CAR or exogenous TCR and/or an inhibitory nucleic acid sequence can be introduced into the genome of an immune cell by random integration. In some such cases, the transgene and/or inhibitory nucleic acid sequence can be randomly integrated by transducing the cell with a lentivirus comprising the transgene and/or inhibitory nucleic acid sequence. In other examples, a transgene encoding a CAR or exogenous TCR and/or inhibitory nucleic acid sequence can be introduced by targeted insertion at a specified location in the genome. In some such cases, targeted integration can be achieved by use of a site- specific, engineered nuclease that generates a cleavage site at a particular location in the genome (e.g., within a target gene), and insertion of a donor template comprising the transgene and/or inhibitory nucleic acid sequence into the cleavage site.

In some examples of the invention, the genetically-modified human immune cells comprise an inactivated TCR alpha gene and/or an inactivated TCR beta gene. In particular examples, the inactivated gene can be a TCR alpha constant region (TRAC) gene or a T cell receptor beta constant region (TRBC) gene. Such gene inactivations can disrupt expression of the endogenous TCR alpha chain and/or the endogenous TCR beta chain, which are each necessary for the assembly of the endogenous alpha/beta TCR. Thus, inactivation of one or more of these genes results in genetically-modified human immune cells that do not have detectable cell surface expression of an endogenous alpha/beta TCR and, in some embodiments, do not have detectable cell surface expression of CD3 which is part of the TCR complex.

In some examples, inactivation of the TCR alpha gene, TCR beta gene, the TRAC gene, and/or the TRBC gene can result from the insertion of a transgene and/or an inhibitory nucleic acid sequence into one of these endogenous genes. Insertion of the transgene and/or inhibitory nucleic acid sequence disrupts expression of the polypeptide encoded by the gene; e.g., the endogenous TCR alpha chain or the endogenous TCR beta chain. In some examples, the transgene encodes the CAR or exogenous TCR, which is expressed by the cell and localized to the cell surface. In some examples, the inhibitory polynucleotide comprises a nucleic acid sequence encoding an inhibitory molecule that inhibits the expression of the dCK protein.

Insertion of one or more donor templates comprising the CAR or exogenous TCR transgene and/or the inhibitory nucleic acid sequence can be achieved by use of an engineered nuclease to generate a cleavage site within a recognition sequence in the genome, such as within the TCR alpha gene, the TRAC gene, the TCR beta gene, or the TRBC gene.

The use of nucleases for disrupting expression of an endogenous TCR gene has been disclosed, including the use of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), megaTALs, and CRISPR systems (e.g., Osborn et al. (2016), Molecular Therapy 24(3): 570-581; Eyquem et al. (2017), Nature 543: 113-117; U.S. Patent No. 8,956,828; U.S. Publication No. US2014/0301990; U.S. Publication No.

US2012/0321667). The specific use of engineered meganucleases for cleaving DNA targets in the human TRAC gene has also been previously disclosed. For example, International Publication No. WO 2014/191527, which disclosed variants of the I-Onul meganuclease that were engineered to target a recognition sequence within exon 1 of the TCR alpha constant region gene. Moreover, in International Publication Nos. WO 2017/062439 and WO 2017/062451, Applicants disclosed engineered meganucleases which have specificity for recognition sequences in exon 1 of the TCR alpha constant region gene. These included “TRC 1-2 meganucleases” which have specificity for the TRC 1-2 recognition sequence (SEQ ID NO: 1) in exon 1 of the TRAC gene. The ‘439 and ‘451 publications also disclosed methods for targeted insertion of a CAR coding sequence or an exogenous TCR coding sequence into a cleavage site in the TCR alpha constant region gene.

Any engineered nuclease can be used for targeted insertion of the donor template, including an engineered meganuclease, a zinc finger nuclease, a TALEN, a compact TALEN, a CRISPR system nuclease, or a megaTAL.

For example, zinc-finger nucleases (ZFNs) can be engineered to recognize and cut pre-determined sites in a genome. ZFNs are chimeric proteins comprising a zinc finger DNA-binding domain fused to a nuclease domain from an endonuclease or exonuclease (e.g., Type Ils restriction endonuclease, such as the FokI restriction enzyme). The zinc finger domain can be a native sequence or can be redesigned through rational or experimental means to produce a protein which binds to a pre-determined DNA sequence ~18 basepairs in length. By fusing this engineered protein domain to the nuclease domain, it is possible to target DNA breaks with genome-level specificity. ZFNs have been used extensively to target gene addition, removal, and substitution in a wide range of eukaryotic organisms (reviewed in S. Durai et al., Nucleic Acids Res 33, 5978 (2005)).

Eikewise, TAL-effector nucleases (TALENs) can be generated to cleave specific sites in genomic DNA. Like a ZFN, a TALEN comprises an engineered, site-specific DNA- binding domain fused to an endonuclease or exonuclease (e.g., Type Ils restriction endonuclease, such as the FokI restriction enzyme) (reviewed in Mak, et al. (2013) Curr Opin Struct Biol. 23:93-9). In this case, however, the DNA binding domain comprises a tandem array of TAL-effector domains, each of which specifically recognizes a single DNA basepair. Compact TALENs are an alternative endonuclease architecture that avoids the need for dimerization (Beurdeley, et al. (2013) Nat Commun. 4:1762). A Compact TALEN comprises an engineered, site-specific TAL-effector DNA-binding domain fused to the nuclease domain from the I-TevI homing endonuclease or any of the endonucleases listed in Table 2 in U.S. Application No. 20130117869. Compact TALENs do not require dimerization for DNA processing activity, so a Compact TALEN is functional as a monomer.

Engineered endonucleases based on the CRISPR/Cas system are also known in the art (Ran, et al. (2013) Nat Protoc. 8:2281-2308; Mali et al. (2013) Nat Methods. 10:957-63). A CRISPR system comprises two components: (1) a CRISPR nuclease; and (2) a short “guide RNA” comprising a ~20 nucleotide targeting sequence that directs the nuclease to a location of interest in the genome. The CRISPR system may also comprise a tracrRNA. By expressing multiple guide RNAs in the same cell, each having a different targeting sequence, it is possible to target DNA breaks simultaneously to multiple sites in the genome.

Engineered meganucleases that bind double- stranded DNA at a recognition sequence that is greater than 12 base pairs can be used for the presently disclosed methods. A meganuclease can be an endonuclease that is derived from LCrel and can refer to an engineered variant of LCrel that has been modified relative to natural LCrel with respect to, for example, DNA-binding specificity, DNA cleavage activity, DNA-binding affinity, or dimerization properties. Methods for producing such modified variants of LCrel are known in the art (e.g. WO 2007/047859, incorporated by reference in its entirety). A meganuclease as used herein binds to double-stranded DNA as a heterodimer. A meganuclease may also be a “single-chain meganuclease” in which a pair of DNA-binding domains is joined into a single polypeptide using a peptide linker.

Nucleases referred to as megaTALs are single-chain endonucleases comprising a transcription activator-like effector (TALE) DNA binding domain with an engineered, sequence-specific homing endonuclease.

The CAR or exogenous TCR transgene and/or inhibitory nucleic acid sequence can be inserted at any position within the TCR alpha gene, the TCR beta gene, the TRAC gene, or the TRBC gene, such that insertion of the transgene and/or inhibitory nucleic acid sequence results in disrupted expression of the endogenous polypeptide; i.e., the endogenous TCR alpha chain or the endogenous TCR beta chain. In some examples, the CAR or exogenous TCR transgene and/or the inhibitory nucleic acid sequence can be inserted in the TRAC gene at a meganuclease recognition sequence comprising SEQ ID NO: 1. In particular examples, the transgene and/or the inhibitory nucleic acid sequence is inserted between positions 13 and 14 of SEQ ID NO: 1.

In particular embodiments, the nucleases used to practice the invention are singlechain meganucleases. A single-chain meganuclease comprises an N-terminal subunit and a C-terminal subunit joined by a linker peptide. Each of the two domains recognizes half of the recognition sequence (i.e., a recognition half-site) and the site of DNA cleavage is at the middle of the recognition sequence near the interface of the two subunits. DNA strand breaks are offset by four base pairs such that DNA cleavage by a meganuclease generates a pair of four base pair, 3' single-strand overhangs. For example, nuclease-mediated insertion using engineered single-chain meganucleases has been disclosed in International Publication Nos. WO 2017/062439 and WO 2017/062451. Nuclease-mediated insertion of the donor template can also be accomplished using an engineered single-chain meganuclease comprising SEQ ID NO: 17.

In some embodiments, mRNA encoding the engineered nuclease is delivered to the cell because this reduces the likelihood that the gene encoding the engineered nuclease will integrate into the genome of the cell. In certain embodiments, an RNA interference (RNAi) molecule (e.g., shRNA, siRNA, miRNA, or shRNAmiR) or an mRNA encoding the same is delivered to the cell.

The mRNA encoding an engineered nuclease or RNAi molecule can be produced using methods known in the art such as in vitro transcription. In some embodiments, the mRNA comprises a modified 5' cap. Such modified 5' caps are known in the art and can include, without limitation, an anti-reverse cap analogs (ARCA) (US7074596), 7-methyl- guanosine, CleanCap® analogs, such as Cap 1 analogs (Trilink; San Diego, CA), or enzymatically capped using, for example, a vaccinia capping enzyme or the like. In some embodiments, the mRNA may be polyadenylated. The mRNA may contain various 5' and 3' untranslated sequence elements to enhance expression of the encoded engineered nuclease or RNAi molecule and/or stability of the mRNA itself. Such elements can include, for example, posttranslational regulatory elements such as a woodchuck hepatitis virus posttranslational regulatory element. The mRNA may contain modifications of naturally-occurring nucleosides to nucleoside analogs. Any nucleoside analogs known in the art are envisioned for use in the present methods. Such nucleoside analogs can include, for example, those described in US 8,278,036. In particular embodiments, nucleoside modifications can include a modification of uridine to pseudouridine, and/or a modification of uridine to N1 -methyl pseudouridine. Purified nuclease proteins can be delivered into cells to cleave genomic DNA, which allows for homologous recombination or non-homologous end-joining at the cleavage site with an exogenous nucleic acid molecule encoding a polypeptide of interest as described herein, by a variety of different mechanisms known in the art, including those further detailed herein. Likewise, RNAi molecules can be delivered to cells using any of the methods known in the art, including those further detailed herein.

In another particular embodiment, a nucleic acid encoding an engineered nuclease or an RNAi molecule can be introduced into the cell using a single-stranded DNA template. The single-stranded DNA can further comprise a 5' and/or a 3' AAV inverted terminal repeat (ITR) upstream and/or downstream of the sequence encoding the engineered nuclease or RNAi molecule. In other embodiments, the single- stranded DNA can further comprise a 5' and/or a 3' homology arm upstream and/or downstream of the sequence encoding the engineered nuclease or RNAi molecule.

In other embodiments, genes encoding a nuclease or RNAi molecule are introduced into a cell using a linearized DNA template. Such linearized DNA templates can be produced by methods known in the art. For example, a plasmid DNA encoding a nuclease or RNAi molecule can be digested by one or more restriction enzymes such that the circular plasmid DNA is linearized prior to being introduced into a cell.

In some embodiments, the nuclease proteins, DNA/mRNA encoding the nuclease, RNAi molecules, or DNA/mRNA encoding the RNAi molecule are coupled to a cell penetrating peptide or targeting ligand to facilitate cellular uptake. Examples of cell penetrating peptides known in the art include poly-arginine (Jearawiriyapaisarn, et al. (2008) Mol Ther. 16:1624-9), TAT peptide from the HIV virus (Hudecz et al. (2005), Med. Res. Rev. 25: 679-736), MPG (Simeoni, et al. (2003) Nucleic Acids Res. 31:2717-2724), Pep-1 (Deshayes et al. (2004) Biochemistry 43: 7698-7706, and HSV-1 VP-22 (Deshayes et al. (2005) Cell Mol Life Sci. 62:1839-49. In an alternative embodiment, engineered nucleases, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding the RNAi molecule are coupled covalently or non-covalently to an antibody that recognizes a specific cell-surface receptor expressed on target cells such that the nuclease protein/DNA/mRNA binds to and is internalized by the target cells. Alternatively, engineered nuclease protein/DNA/mRNA or RNAi molecule/DNA/mRNA can be coupled covalently or non- covalently to the natural ligand (or a portion of the natural ligand) for such a cell-surface receptor. (McCall, et al. (2014) Tissue Barriers. 2(4):e944449; Dinda, et al. (2013) Curr Pharm Biotechnol. 14:1264-74; Kang, et al. (2014) Curr Pharm Biotechnol. 15(3):220-30; Qian et al. (2014) Expert Opin Drug Metab Toxicol. 10(11): 1491-508).

In some embodiments, nuclease proteins, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding RNAi molecules are encapsulated within biodegradable hydrogels for injection or implantation within the desired region of the liver (e.g., in proximity to hepatic sinusoidal endothelial cells or hematopoietic endothelial cells, or progenitor cells which differentiate into the same). Hydrogels can provide sustained and tunable release of the therapeutic pay load to the desired region of the target tissue without the need for frequent injections, and stimuli-responsive materials (e.g., temperature- and pH- responsive hydrogels) can be designed to release the payload in response to environmental or externally applied cues (Kang Derwent et al. (2008) Trans Am Ophthalmol Soc. 106:206- 214).

In some embodiments, nuclease proteins, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding RNAi molecules are coupled covalently or, preferably, non-covalently to a nanoparticle or encapsulated within such a nanoparticle using methods known in the art (Sharma, et al. (2014) Biomed Res Int. 2014). A nanoparticle is a nanoscale delivery system whose length scale is <1 pm, preferably <100 nm. Such nanoparticles may be designed using a core composed of metal, lipid, polymer, or biological macromolecule, and multiple copies of the nuclease proteins, RNAi molecules, mRNA, or DNA can be attached to or encapsulated within the nanoparticle core. This increases the copy number of the protein/mRNA/DNA that is delivered to each cell and, so, increases the intracellular expression of each nuclease to maximize the likelihood that the target recognition sequences will be cut. The surface of such nanoparticles may be further modified with polymers or lipids (e.g., chitosan, cationic polymers, or cationic lipids) to form a core-shell nanoparticle whose surface confers additional functionalities to enhance cellular delivery and uptake of the payload (Jian et al. (2012) Biomaterials. 33(30): 7621-30). Nanoparticles may additionally be advantageously coupled to targeting molecules to direct the nanoparticle to the appropriate cell type and/or increase the likelihood of cellular uptake. Examples of such targeting molecules include antibodies specific for cell- surface receptors and the natural ligands (or portions of the natural ligands) for cell surface receptors.

In some embodiments, the nuclease proteins, DNA/mRNA encoding the nucleases, the RNAi molecules, or DNA/mRNA encoding the RNAi molecules are encapsulated within liposomes or complexed using cationic lipids (see, e.g., LIPOFECTAMINE™, Life Technologies Corp., Carlsbad, CA; Zuris et al. (2015) Nat Biotechnol. 33: 73-80; Mishra et al. (2011) J Drug Deliv. 2011:863734). The liposome and lipoplex formulations can protect the payload from degradation, enhance accumulation and retention at the target site, and facilitate cellular uptake and delivery efficiency through fusion with and/or disruption of the cellular membranes of the target cells.

In some embodiments, nuclease proteins, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding RNAi molecules are encapsulated within polymeric scaffolds (e.g., PLGA) or complexed using cationic polymers (e.g., PEI, PLL) (Tamboli et al. (2011) Ther Deliv. 2(4): 523-536). Polymeric carriers can be designed to provide tunable drug release rates through control of polymer erosion and drug diffusion, and high drug encapsulation efficiencies can offer protection of the therapeutic payload until intracellular delivery to the desired target cell population.

In some embodiments, nuclease proteins, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding RNAi molecules are combined with amphiphilic molecules that self-assemble into micelles (Tong et al. (2007) J Gene Med. 9(11): 956-66). Polymeric micelles may include a micellar shell formed with a hydrophilic polymer (e.g., polyethyleneglycol) that can prevent aggregation, mask charge interactions, and reduce nonspecific interactions.

In some embodiments, nuclease proteins, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding RNAi molecules are formulated into an emulsion or a nanoemulsion (z.e., having an average particle diameter of < Inm) for administration and/or delivery to the target cell. The term “emulsion” refers to, without limitation, any oil-in-water, water-in-oil, water-in-oil-in-water, or oil-in-water-in-oil dispersions or droplets, including lipid structures that can form as a result of hydrophobic forces that drive apolar residues (e.g., long hydrocarbon chains) away from water and polar head groups toward water, when a water immiscible phase is mixed with an aqueous phase. These other lipid structures include, but are not limited to, unilamellar, paucilamellar, and multilamellar lipid vesicles, micelles, and lamellar phases. Emulsions are composed of an aqueous phase and a lipophilic phase (typically containing an oil and an organic solvent). Emulsions also frequently contain one or more surfactants. Nanoemulsion formulations are well known, e.g., as described in US Pat. Nos. 6,015,832, 6,506,803, 6,635,676, 6,559,189, and 7,767,216, each of which is incorporated herein by reference in its entirety.

In some embodiments, nuclease proteins, DNA/mRNA encoding nucleases, RNAi molecules, or DNA/mRNA encoding RNAi molecules are covalently attached to, or non- covalently associated with, multifunctional polymer conjugates, DNA dendrimers, and polymeric dendrimers (Mastorakos et al. (2015) Nanoscale. 7(9): 3845-56; Cheng et al. (2008) J Pharm Sci. 97(1): 123-43). The dendrimer generation can control the payload capacity and size, and can provide a high pay load capacity. Moreover, display of multiple surface groups can be leveraged to improve stability, reduce nonspecific interactions, and enhance cell-specific targeting and drug release.

Methods of introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical, or biological means. Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). A preferred method for the introduction of a polynucleotide into a host cell is calcium phosphate transfection. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors, and include viral vectors.

In some embodiments, genes encoding a nuclease or RNAi molecules are delivered using a virus. Such viruses are known in the art and include retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses (AAVs) (reviewed in Vannucci, et al. (2013 New Microbiol. 36:1-22). AAVs useful in the invention can have any serotype that allows for transduction of the virus into a target cell type and expression of the nuclease gene or RNAi molecule in the target cell. In particular embodiments, AAVs have a serotype of AAV2 or AAV6. AAVs can be single-stranded AAVs or alternatively, can be self-complementary such that they do not require second-strand DNA synthesis in the host cell (McCarty, et al. (2001) Gene Ther. 8:1248-54).

If the nuclease genes are delivered in DNA form (e.g. plasmid) and/or via a virus (e.g. AAV) they must be operably linked to a promoter. In some embodiments, this can be a viral promoter such as endogenous promoters from the virus (e.g. the LTR of a lentiviral vector) or the well-known cytomegalovirus- or SV40 virus-early promoters. In a preferred embodiment, nuclease genes are operably linked to a promoter that drives gene expression preferentially in the target cell. In some examples, nuclease genes are operably linked to a synthetic promoter, such as a JeT promoter (US 6555674). One or more donor templates (e.g., a template nucleic acid) comprising the CAR or exogenous TCR transgene and/or the inhibitory nucleic acid sequence is inserted into a cleavage site in the targeted genes. In some embodiments, the donor template comprises a 5' homology arm and a 3' homology arm flanking the transgene and/or inhibitory nucleic acid sequence and elements of the insert. Such homology arms have sequence homology to corresponding sequences 5' upstream and 3' downstream of the nuclease recognition sequence where a cleavage site is produced. In general, homology arms can have a length of at least 50 base pairs, preferably at least 100 base pairs, and up to 2000 base pairs or more, and can have at least 90%, preferably at least 95%, or more, sequence homology to their corresponding sequences in the genome.

In some such cases, the cassettes or template nucleic acids of the invention may not require an exogenous promoter in order for the encoded sequences to be expressed. Further, in such cases, the cassettes or template nucleic acids may comprise elements (e.g., splice acceptor sequences, 2A or IRES sequences, and the like) necessary for the nucleic acids to be operably linked to the endogenous promoter. In other embodiments, the cassettes or template nucleic acids of the invention comprise one or more exogenous promoters that are operably linked to the nucleic acid sequences and drive expression of the CAR or exogenous TCR and/or inhibitory nucleic acid sequence.

In certain embodiments, the donor template comprises at least two cassettes, wherein the CAR or exogenous TCR transgene is operably linked to a first promoter and the inhibitory nucleic acid sequence is operably linked to a second promoter. In some of these embodiments, the first and second promoter are identical. In other embodiments, the first and second promoter are different from one another. In some embodiments, the promoter operably linked to the CAR or exogenous TCR transgene is a Pol II promoter. In certain embodiments, the promoter operably linked to the inhibitory nucleic acid sequence is a Pol II or Pol III promoter. In some of those embodiments wherein the donor template comprises at least two cassettes, the CAR or exogenous TCR transgene comprises a first transcriptional termination sequence and the inhibitory nucleic acid sequence comprises a second transcriptional termination sequence. In some of these embodiments, the first and second transcriptional termination sequence are identical. In other embodiments, the first and second transcriptional termination sequence are different from one another.

In some embodiments, the donor template comprises a single cassette comprising a CAR or exogenous TCR transgene and an inhibitory nucleic acid sequence, wherein the cassette comprises a single exogenous promoter operably linked to both the CAR or exogenous TCR transgene and the inhibitory nucleic acid sequence. In some of these embodiments, the single exogenous promoter is a Pol II promoter. In some embodiments, the single cassette further comprises a single transcriptional termination sequence downstream of the transgene and inhibitory nucleic acid sequence. In particular embodiments, the first and second cassettes can be in the same orientation. This orientation can be either 5' to 3' relative to the homology arms or, alternatively, 3' to 5'. In either case, the first cassette may be 5' to the second cassette, or the second cassette may be 5' to the first cassette. In other embodiments, the first and second cassettes can be in different orientations in the donor template. For example, the first cassette may be oriented 5' to 3', whereas the second cassette may be oriented 3' to 5'. Alternatively, the first cassette may be oriented 3' to 5' and the second cassette may be oriented 5' to 3'.

In embodiments wherein the cassettes are in opposite orientations, they may be oriented in a “tail-to-tail” configuration, such that the first cassette is oriented 3' to 5' and is positioned 5' to the second cassette, which is oriented 5' to 3'. In a similar tail-to-tail embodiment, the second cassette is oriented 3' to 5' and is positioned 5' to the first cassette, which is oriented 5' to 3'.

In other embodiments wherein the cassettes are in opposite orientations, they may be oriented in a “head-to-head” configuration, such that the first cassette is oriented 5' to 3' and is positioned 5' to the second cassette, which is oriented 3' to 5'. In a similar head-to-head embodiment, the second cassette is oriented 5' to 3' and is positioned 5' to the first cassette, which is oriented 3' to 5'.

Similarly, each of the coding sequences can be present in the genome in the same orientation or in different orientations from each other. For example, one coding sequence can be on the plus strand of the double- stranded DNA and another coding sequence on the minus strand. In some embodiments, the inhibitory nucleic acid sequence is 3' downstream of the transgene encoding the CAR or exogenous TCR. In alternative embodiments, the inhibitory nucleic acid sequence is 5' upstream of the CAR/TCR-encoding transgene.

In some embodiments, the CAR or exogenous TCR transgene and/or the inhibitory nucleic acid sequence is operably linked to a Pol II promoter. One example of a suitable Pol II promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Another example of a suitable Pol II promoter is Elongation Growth Factor-la (EF-la). However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.

Synthetic promoters are also contemplated as part of the present disclosure. For example, in particular embodiments, the promoter driving expression of the engineered antigen receptor is a JeT promoter (see, WO/2002/012514).

In some embodiments, the promoters are selected based on the desired outcome. It is recognized that different applications can be enhanced by the use of different promoters in the cassettes to modulate the timing, location and/or level of expression of the polynucleotides disclosed herein. Such expression constructs may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.

Promoters particularly useful for driving expression of an RNA interference molecule are well known in the art and can include, without limitation, pol III promoters, such as U6 or Hl.

The transgene encoding the CAR or exogenous TCR and/or the inhibitory nucleic acid sequence can further comprise additional control sequences. For example, the sequence can include homologous recombination enhancer sequences, Kozak sequences, polyadenylation sequences, transcriptional termination sequences, selectable marker sequences (e.g., antibiotic resistance genes), origins of replication, and the like. Sequences encoding engineered nucleases can also include at least one nuclear localization signal. Examples of nuclear localization signals are known in the art (see, e.g., Eange et al., J. Biol. Chem., 2007, 282:5101-5105). In some embodiments, a single donor template comprising the CAR or exogenous TCR transgene and the inhibitory nucleic acid sequence is inserted into the cleavage site of a target gene. In other embodiments, a first donor template comprising a CAR or exogenous TCR transgene is inserted into a first cleavage site of a first target gene, and a second donor template comprising an inhibitory nucleic acid sequence is inserted into a second cleavage site of a second target gene. In some of these embodiments, the first and second cleavage site are within the same target gene. In other embodiments, the first and second target gene are different from each other. In some embodiments, the first donor template is introduced into a cell and subsequently into the genome before the second donor template is introduced. In other embodiments, the first donor template is introduced into a cell and subsequently into the genome after the second donor template is introduced. In yet other embodiments, the first and second donor template are introduced into a cell simultaneously.

A donor template comprising the CAR or exogenous TCR transgene and/or inhibitory nucleic acid sequence can be introduced into the cell by any of the means previously discussed. In a particular embodiment, the donor template is introduced by way of a virus, such as a recombinant AAV. AAVs useful for introducing an exogenous nucleic acid can have any serotype that allows for transduction of the virus into the cell and insertion of the exogenous nucleic acid sequence into the cell genome. In particular embodiments, the AAVs have a serotype of AAV2 or AAV6. AAVs can be single-stranded AAVs or, alternatively, can be self-complementary such that they do not require second-strand DNA synthesis in the host cell. In certain embodiments, the transgene for the CAR or the exogenous TCR and/or the inhibitory nucleic acid sequence is operably-linked to a promoter such as, for example, a JeT promoter.

In order to assess the expression of an engineered antigen receptor (e.g. a CAR or exogenous T cell receptor) in a genetically-modified cell, the nucleic acid molecule of the invention can optionally comprise an epitope which can be used to detect the presence of the encoded cell surface protein. In some examples described herein, a CAR coding sequence may include a QBendlO epitope which allows for detection using an anti-CD34 antibody (see, WO2013/153391).

In other examples, a cassette can also contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a cotransfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic -resistance genes and fluorescent marker genes.

Expression may also be assessed by determining protein expression of the polypeptide targeted by the inhibitory nucleic acid sequence using any method known in the art.

In another particular embodiment, the donor template comprising the CAR or exogenous TCR transgene and/or inhibitor polynucleotide can be introduced into the cell using a single-stranded DNA template. The single- stranded DNA can comprise the exogenous sequence of interest and, in preferred embodiments, can comprise 5' and 3' homology arms to promote insertion of the nucleic acid sequence into the cleavage site by homologous recombination. The single- stranded DNA can further comprise a 5' AAV inverted terminal repeat (ITR) sequence 5' upstream of the 5' homology arm, and a 3' AAV ITR sequence 3' downstream of the 3' homology arm.

In another particular embodiment, the donor template comprising the CAR or exogenous TCR transgene and/or inhibitor polynucleotide can be introduced into the cell by transfection with a linearized DNA template. In some examples, a plasmid DNA can be digested by one or more restriction enzymes such that the circular plasmid DNA is linearized prior to transfection into the cell.

2.6 Pharmaceutical Compositions

The method of the invention comprises administering a pharmaceutical composition comprising a population of human immune cells, including a plurality of genetically- modified human immune cells. Such pharmaceutical compositions can be prepared in accordance with known techniques. See, e.g., Remington, The Science and Practice of Pharmacy (21st ed. 2005). In the manufacture of a pharmaceutical formulation according to the invention, cells are typically admixed with a pharmaceutically acceptable carrier and the resulting composition is administered to a subject. The carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be deleterious to the subject. In some embodiments, pharmaceutical compositions used in the invention can further comprise one or more additional agents useful in the treatment of a disease in the subject. In additional embodiments, pharmaceutical compositions of the invention can further include biological molecules, such as cytokines (e.g., IL-2, IL-7, IL- 15, and/or IL-21), which may promote in vivo cell proliferation and engraftment of genetically- modified human immune cells. Pharmaceutical compositions comprising genetically- modified human immune cells used in the invention can be administered in the same composition as an additional agent or biological molecule or, alternatively, can be coadministered in separate compositions.

The present disclosure also provides genetically-modified human immune cells, or populations thereof, described herein for use as a medicament. The present disclosure further provides the use of genetically-modified human immune cells or populations thereof described herein in the manufacture of a medicament for treating a disease in a subject in need thereof. In one such aspect, the medicament is useful for cancer immunotherapy in subjects in need thereof.

2.7 Methods of Administering Populations of Human Immune Cells

The method of the invention comprises administering to a subject a pharmaceutical composition comprising a population of human immune cells, wherein the population comprises a plurality of genetically-modified human immune cells. For example, the pharmaceutical composition administered to the subject can comprise an effective dose of genetically-modified human immune cells (e.g., CAR T cells or CAR NK cells) for treatment of a cancer or other disease and administration of the genetically-modified human immune cells of the invention represent an immunotherapy. The administered genetically-modified human immune cells are able to reduce the proliferation, reduce the number, or kill target cells in the recipient.

Unlike antibody therapies, genetically-modified human cells of the present disclosure are able to replicate and expand in vivo, resulting in long-term persistence that can lead to sustained control of a disease.

When an “effective amount” or “therapeutic amount” is indicated, the precise amount to be administered can be determined by a physician with consideration of individual differences in age, weight, disease state, tumor size (if present), extent of infection or metastasis, and condition of the patient (subject). In some embodiments, a pharmaceutical composition comprising the genetically-modified human immune cells or populations thereof described herein is administered at a dosage of 0.1 x 10⁶ (i.e., 1 x 10⁵) to 1.0 x 10⁹ cells/kg body weight, including all integer values within those ranges. In particular embodiments, the dosage is 0.3 x 10⁶ to 6.0 x 10⁶ cells/kg body weight, including all integer values within those ranges. In further embodiments, the dosage is 0.3 x 10⁶ to 6.0 x 10⁶ cells/kg body weight, including all integer values within those ranges. In other embodiments, the dosage is 0.5 x 10⁶ to 3.0 x 10⁶ cells/kg body weight, including all integer values within those ranges. Dosages of genetically-modified human immune cells can include any of the dosages described herein. In some embodiments, cell compositions are administered multiple times at these dosages. The cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.

In some embodiments of the methods described herein, the pharmaceutical composition is administered at a dose of between about 1 xlO⁵ and about 1 xlO⁹, about 0.3 x 10⁶ and about 6 x 10⁶, or about 0.5 x 10⁶ and about 3 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 1 x 10⁵, about 2 x 10⁵, about 3 x 10⁵, about 4 x 10⁵, about 5 x 10⁵, about 6 x 10⁵, about 7 x 10⁵, about 8 x 10⁵, about 9 x 10⁵, about 1 x 10⁶, about 2 x 10⁶, about 3 x 10⁶, about 4 x 10⁶, about 5 x 10⁶, about 6 x 10⁶, about 7 x 10⁶, about 8 x 10⁶, about 9 x 10⁶, about 1 x 10⁷, about 2 x 10⁷, about 3 x 10⁷, about 4 x 10⁷, about 5 x 10⁷, about 6 x 10⁷, about 7 x 10⁷, about 8 x 10⁷, about 9 x 10⁷, about 1 x 10⁸, about 2 x 10⁸, about 3 x 10⁸, about 4 x 10⁸, about 5 x 10⁸, about 6 x 10⁸, about 7 x 10⁸, about 8 x 10⁸, about 9 x 10⁸, or about 1 x 10⁹ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 0.5 x 10⁶ genetically- modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 1 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 1.5 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 2 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 2.5 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 3 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 270 x 10⁶ genetically-modified human immune cells/kg. In some of these embodiments, the pharmaceutical composition is administered at a dose of about 500 x 10⁶ genetically-modified human immune cells/kg.

Examples of possible routes of administration of compositions comprising genetically-modified human immune cells include parenteral, (e.g., intravenous (IV), intramuscular (IM), intradermal, subcutaneous (SC), or infusion) administration. Examples of possible routes of administration of lymphodepletion regimens described herein include parenteral (e.g., intravenous (IV), intramuscular (IM), intradermal, subcutaneous (SC), or infusion) administration or oral administration. Moreover, the administration may be by continuous infusion or by single or multiple boluses. In specific embodiments, the genetically-modified human immune cells or the one or more chemotherapeutic lymphodepletion agent is infused over a period of less than about 12 hours, less than about 10 hours, less than about 8 hours, less than about 6 hours, less than about 4 hours, less than about 3 hours, less than about 2 hours, or less than about 1 hour. In still other embodiments, the infusion occurs slowly at first and then is increased over time.

Pharmaceutical compositions of the invention can be useful for treating any disease state such as, for example, diseases that can be targeted by adoptive immunotherapy. In a particular embodiment, the presently disclosed methods are useful in the treatment of cancer. In some embodiments, the presently disclosed methods comprise administering a pharmaceutical composition comprising genetically-modified human immune cells targeting a cancer cell antigen (i.e., an antigen expressed on the surface of a cancer cell) for the purpose of treating cancer. Such cancers can include, without limitation, any of the cancers described herein.

In some embodiments, the presently disclosed methods reduce at least one symptom of a cancer. Symptoms of cancers are well known in the art and can be determined by known techniques. Further, the presently disclosed methods can reduce the number of cancer cells or the size of a cancer (e.g., a tumor) in a subject. Methods for determining the number of cancer cells or the size of a cancer (e.g., a tumor) in a subject vary based on the cancer being treated. Such methods are well known in the art and reductions in cancer cell numbers and tumor number and/or size can be determined by known techniques. In some embodiments, the presently disclosed methods eradicate cancer (i.e., no detectable tumor or cancer cells) in the subject.

In some of these embodiments wherein cancer is treated, the subject can be further administered an additional therapeutic agent or treatment, including, but not limited to gene therapy, radiation, surgery, or a chemotherapeutic agent(s) (i.e., chemotherapy).

2.8 Variants

The present invention utilizes variants of the polypeptide and polynucleotide sequences described herein. As used herein, “variants” is intended to mean substantially similar sequences. A “variant” polypeptide is intended to mean a polypeptide derived from the “native” polypeptide by deletion or addition of one or more amino acids at one or more internal sites in the native protein and/or substitution of one or more amino acids at one or more sites in the native polypeptide. As used herein, a “native” polynucleotide or polypeptide comprises a parental sequence from which variants are derived. Variant polypeptides encompassed by the embodiments are biologically active. That is, they continue to possess the desired biological activity of the native protein. Such variants may result, for example, from human manipulation. Biologically active variants of polypeptides described herein will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, sequence identity to the amino acid sequence of the native polypeptide, as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a polypeptide may differ from that polypeptide or subunit by as few as about 1-40 amino acid residues, as few as about 1-20, as few as about 1-10, as few as about 5, as few as 4, 3, 2, or even 1 amino acid residue.

The polypeptides may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants can be prepared by mutations in the DNA. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al.

(1987) Methods in Enzymol. 154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be optimal.

For polynucleotides, a “variant” comprises a deletion and/or addition of one or more nucleotides at one or more sites within the native polynucleotide. One of skill in the art will recognize that variants of the nucleic acids of the embodiments will be constructed such that the open reading frame is maintained. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides of the embodiments. Variant polynucleotides include synthetically derived polynucleotides, such as those generated, for example, by using site- directed mutagenesis but which still encode a polypeptide or RNA. Generally, variants of a particular polynucleotide of the embodiments will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein. Variants of a particular polynucleotide (e.g., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide.

The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the polypeptide. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by screening the polypeptide for its biological activity.

EXAMPLES

This invention is further illustrated by the following examples, which should not be construed as limiting. Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are intended to be encompassed in the scope of the claims that follow the examples below.

EXAMPLE 1

In vitro knockdown of dCK and characterization of FluR CAR T cells

1. _ Methods

Knockdown of dcK was accomplished using an RNAi sequence featuring a dCK- specific shRNA sequence embedded into a micro-RNA backbone (i.e, a shRNAmiR). The resulting RNAi sequence demonstrated the potency of shRNA and the stability of a microRNA. Using Precision BioSciences’ ARCUS gene editing technology and AAV- mediated targeted transgene insertion strategy, we disrupted the endogenous T cell receptor and inserted a transgene encoding a CD19-specific CAR and a dCK-specific RNAi sequence into the T cell receptor alpha constant (TRAC) locus. To generate CAR T cells, we introduced mRNA into donor human T cells encoding a TRC 1-2L.1592 meganuclease that generates a cleavage site in the TRAC gene at SEQ ID NO: 1 (i.e., the TRC 1-2 recognition sequence). The donor human T cells were also transduced with an AAV comprising the construct illustrated in Figure 1, which comprises 5' and 3' homology arms (having homology to sequences upstream and downstream of the TRC 1-2 recognition sequence), flanking a JET promoter, a coding sequence for a CD19-specific CAR, a polyA sequence, a U6 promoter, a dCK-specific shRNAmiR (72136, set forth in SEQ ID NO: 2), and a cPPT termination sequence. The homology arms promoted insertion of the donor template into the cleavage site generated by the TRC 1-2L.1592 meganuclease, allowing for expression of the CAR and shRNAmiR, and knockout of the TRAC gene (and subsequent knockout of the endogenous alpha/beta TCR on the cell surface). Cells produced in this manner, referred to as FluR CAR T cells, were exposed to CD 19+ target cells in vitro and in immune-deficient mice and CAR T proliferation and target killing were monitored in the presence and absence of fludarabine.

2. _ Results

As shown in Figures 1 and 2, CAR T cells expressing a dCK shRNAmiR (Figure 1) had reduced dCK mRNA abundance (Figure 2A), conferring resistance and the ability to proliferate in the presence fludarabine (Figure 2B), as well as the ability to work as a selection system helping in CAR enrichment (Figure 2C).

EXAMPEE 2

Anti-CD19 CAR+ cells with dcK knockdown (FluR CAR T’s) in the presence of fludarabine display efficient antitumor response to CD 19 expressing tumor cells in vitro

1. _ Methods

3 days post transduction CAR T and FluR CAR T cells were treated +/- 6uM fludarabine for 8 days. Cells were then depleted of CD3+ cells. Enriched CD3- cells were cultured for 3 additional days in the presence of IL- 15 + IL-21 and then tested in xCELLigence real-time cell analysis (RTCA) assay. RTCA is a technique based on impedance and microsensor electrodes and is used as a label-free, real-time system to detect the killing of target cells by effector cells. Stepl: Adherent target cells (i.e. tumor cells) are first seeded in the wells of an electronic microtiter plate. Adhesion of target cells to the gold microelectrodes impedes the flow of electric current between electrodes. Impedance is measured as a unitless parameter called Cell Index. Step 2: Nonadherent effector added, which themselves do not cause change in impedance. Step 3: If the effector cells attack the target cancer cells, the destruction of the tumor cells is reflected by a decrease in Cell Index over time. Experimental groups are shown in Figure 3.

2. _ Results

Results of the RTCA experiment are summarized in Figure 4 and Figure 5, and demonstrate that FluR CAR T cells maintained their ability to kill target cells in both the absence and presence of fludarabine, indicating that the shRNAmiR knockdown was effective in providing resistance to the drug without sacrificing efficacy.

EXAMPEE 3

In vivo study of FluR CAR T cells combined with fludarabine administration

1. _ Methods and Results

These studies were conducted to evaluate the efficacy of FluR CAR T cells, with or without administration of fludarabine, in a NALM-6 model of Acute Lymphoblastic Leukemia (ALL). The general experimental protocol is illustrated in Figure 6.

2. _ Results

Anti CD 19+ FluR CAR T cells, in the presence of fludarabine, showed enhanced tumor clearance and survival compared to mice treated with anti-CD19+ CAR T’s alone or Anti CD 19+ CAR T cells plus fludarabine in a murine model of ALL, as shown by ventral average total flux (Figure 7 and Figure 8).

Overall, these studies of FluR CAR T cells (expressing a dCK-specific RNAi) resulted in 70% reduction in dCK mRNA abundance, and conferred resistance to fludarabine in vitro and in vivo. These data suggest that the drug resistance feature may enable allogeneic CAR T cells to be simultaneously administered with fludarabine, suppressing rejection of CAR T and improving CAR T engraftment and expansion. This synergy between conditioning and CAR T therapy may improve clinical outcomes by enhancing effector persistence and tumor clearing. Sequence Listing

SEQ ID NO: 1

TGGCCTGGAGCAACAAATCTGA

SEQ ID NO: 2

CTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAA

CACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA

TTGCTGTTGACAGTGAGCGCGCAAGGCATTCCTCTTGAATATAGTGAAGCCACAG

ATGTATATTCAAGAGGAATGCCTTGCTTGCCTACTGCCTCGGACTTCAAGGGGCT

AGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGAT

ACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTGC

SEQ ID NO: 3

CTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAA

CACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA

TTGCTGTTGACAGTGAGCGCGGCATTCCTCTTGAATATTTATAGTGAAGCCACAG

ATGTATAAATATTCAAGAGGAATGCCTTGCCTACTGCCTCGGACTTCAAGGGGCT

AGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGAT

ACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTGC

SEQ ID NO: 4

CTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAA

CACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA

TTGCTGTTGACAGTGAGCGCGGTTTCTTATTCAAAGATGATTAGTGAAGCCACAG

ATGTAATCATCTTTGAATAAGAAACCATGCCTACTGCCTCGGACTTCAAGGGGCT

AGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGAT

ACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTGC SEQ ID NO: 5

CTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAA

CACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA

TTGCTGTTGACAGTGAGCGAGCTCCTGCATAGGACACTGAATAGTGAAGCCACA

GATGTATTCAGTGTCCTATGCAGGAGCCTGCCTACTGCCTCGGACTTCAAGGGGC

TAGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGA

TACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTGC

SEQ ID NO: 6

CTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAA

CACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA

TTGCTGTTGACAGTGAGCGCGGCTAGAAAGCATCCATTAATTAGTGAAGCCACA

GATGTAATTAATGGATGCTTTCTAGCCTTGCCTACTGCCTCGGACTTCAAGGGGC

TAGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGA

TACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTGC

SEQ ID NO: 7

CGCAAGGCATTCCTCTTGAATA

SEQ ID NO: 8

TATTCAAGAGGAATGCCTTGCT

SEQ ID NO: 9

CGGCATTCCTCTTGAATATTTA

SEQ ID NO: 10

TAAATATTCAAGAGGAATGCCT

SEQ ID NO: 11

CGGTTTCTTATTCAAAGATGAT

SEQ ID NO: 12

ATCATCTTTGAATAAGAAACCA SEQ ID NO: 13

AGCTCCTGCATAGGACACTGAA

SEQ ID NO: 14

TTCAGTGTCCTATGCAGGAGCC

SEQ ID NO: 15

CGGCTAGAAAGCATCCATTAAT

SEQ ID NO: 16

ATTAATGGATGCTTTCTAGCCT

SEQ ID NO: 17

CTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAA

CACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA

TTGCTGTT

SEQ ID NO: 18

GACAGTGAGCG

SEQ ID NO: 19

TAGTGAAGCCACAGATGTA

SEQ ID NO: 20

TGCCTACTGCC

SEQ ID NO: 21

TCGGACTTCAAGGGGCTAGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATA

CCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAA

ATCACTTTGC

Claims

1. A method of reducing the number of target cells in a subject, said method comprising:

(a) administering to said subject a lymphodepletion regimen comprising an effective dose of one or more chemotherapeutic lymphodepletion agents; and

(b) administering to said subject an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein a plurality of said human immune cells are genetically-modified human immune cells; wherein said genetically-modified human immune cells comprise a cell surface engineered antigen receptor having specificity for an antigen on said target cells; wherein said genetically-modified human immune cells exhibit reduced expression of deoxycytidine kinase (dCK) protein compared to control cells; wherein said one or more chemotherapeutic lymphodepletion agents includes a nucleoside analog; and wherein said method reduces the number of said target cells in said subject.

2. A method for reducing host rejection of genetically-modified human immune cells in a subject, said method comprising:

(b) administering to said subject an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein a plurality of said human immune cells are said genetically-modified human immune cells; wherein said genetically-modified human immune cells comprise a cell surface engineered antigen receptor having specificity for an antigen on target cells in said subject; wherein said genetically-modified human immune cells exhibit reduced expression of dCK protein compared to control cells; wherein said one or more chemotherapeutic lymphodepletion agents includes a nucleoside analog; and wherein rejection of said genetically-modified human immune cells by host immune cells is reduced.

85

3. A method for reducing nucleoside analog -induced killing of genetically- modified human immune cells in a subject, said method comprising:

(b) administering to said subject an effective dose of a pharmaceutical composition comprising a population of human immune cells, wherein a plurality of said human immune cells are genetically-modified human immune cells; wherein said genetically-modified human immune cells comprise a cell surface engineered antigen receptor having specificity for an antigen on target cells in said subject; wherein said genetically-modified human immune cells exhibit reduced expression of dCK protein compared to control cells; wherein said one or more chemotherapeutic lymphodepletion agents includes said nucleoside analog; and wherein nucleoside analog-induced killing of said genetically-modified human immune cells is reduced.

4. The method of any one of claims 1-3, wherein said genetically-modified human immune cells exhibit greater resistance to said nucleoside analog compared to control cells that do not exhibit reduced expression of dCK protein.

5. The method of any one of claims 1-4, wherein said human immune cells are human T cells, human natural killer (NK cells), human macrophages, or human B cells.

6. The method of any one of claims 1-5, wherein said human immune cells are not derived from said subject.

7. The method of any one of claims 1-6, wherein said engineered antigen receptor is a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR).

8. The method of any one of claims 1-7, wherein said genetically-modified human immune cells comprise in their genome a polynucleotide comprising a nucleic acid sequence encoding said engineered antigen receptor.

86

9. The method of claim 8, wherein said polynucleotide comprises an exogenous promoter that is operably linked to said nucleic acid sequence encoding said engineered antigen receptor.

10. The method of claim 9, wherein said promoter is a Pol II promoter.

11. The method of any one of claims 8-10, wherein said polynucleotide comprises a termination sequence.

12. The method of any one of claims 8-11, wherein said polynucleotide is positioned within a gene, and wherein expression of said gene is disrupted by said polynucleotide.

13. The method of claim 12, wherein said gene is a T cell receptor alpha gene, a T cell receptor alpha constant region (TRAC) gene, a T cell receptor beta gene, or a T cell receptor beta constant region (TRBC) gene.

14. The method of claim 12 or claim 13, wherein said gene is a TRAC gene, and wherein said polynucleotide is positioned within SEQ ID NO: 1.

15. The method of any one of claims 12-14, wherein said gene is a TRAC gene, and wherein said polynucleotide is positioned between nucleotide 13 and 14 of SEQ ID NO: 1.

16. The method of any one of claims 1-15, wherein said genetically-modified human immune cells comprise an inhibitory molecule that is inhibitory against dCK.

17. The method of claim 16, wherein said inhibitory molecule is an inhibitory nucleic acid molecule.

18. The method of claim 17, wherein said inhibitory nucleic acid molecule is an RNA interference (RNAi) molecule.

87

19. The method of claim 18, wherein said RNAi molecule is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a microRNA (miRNA), or a microRN A- adapted shRNA (shRNAmiR).

20. The method of claim 18 or claim 19, wherein said RNAi molecule is a shRNAmiR.

21. The method of claim 19 or claim 20, wherein said shRNAmiR comprises a nucleic acid sequence having at least 80% sequence identity to a sequence set forth in SEQ ID NO: 2.

22. The method of any one of claims 19-21, wherein said shRNAmiR comprises a nucleic acid sequence set forth in SEQ ID NO: 2.

23. The method of any one of claims 1-22, wherein said genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 5% to about 95% compared to control cells.

24. The method of any one of claims 1-23, wherein said genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 30% to about 90% compared to control cells.

25. The method of any one of claims 1-24, wherein said genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 50% to about 85% compared to control cells.

26. The method of any one of claims 1-25, wherein said genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 60% to about 80% compared to control cells.

27. The method of any one of claims 1-26, wherein said genetically-modified human immune cells exhibit a reduction of dCK protein expression of between about 65% to about 75% compared to control cells.

88

28. The method of any one of claims 1-27, wherein said genetically-modified human immune cells exhibit a reduction of dCK protein expression of about 70% compared to control cells.

29. The method of any one of claims 16-28, wherein said genetically-modified human immune cells comprise in their genome an inhibitor polynucleotide comprising a nucleic acid sequence encoding said inhibitory molecule.

30. The method of claim 29, wherein said inhibitor polynucleotide comprises an exogenous promoter that is operably linked to said nucleic acid sequence encoding said inhibitory molecule.

31. The method of claim 30, wherein said exogenous promoter is a Pol II or a Pol III promoter.

32. The method of any one of claims 29-31, wherein said inhibitor polynucleotide comprises a termination sequence.

33. The method of any one of claims 29-32, wherein said inhibitor polynucleotide is positioned within a gene, and wherein expression of said gene is disrupted by said inhibitor polynucleotide.

34. The method of claim 33, wherein said gene is a T cell receptor alpha gene, a T cell receptor alpha constant region (TRAC) gene, a T cell receptor beta gene, or a T cell receptor beta constant region (TRBC) gene.

35. The method of claim 33 or claim 34, wherein said gene is a TRAC gene, and wherein said inhibitor polynucleotide is positioned within SEQ ID NO: 1.

36. The method of any one of claims 33-35, wherein said gene is a TRAC gene, and wherein said inhibitor polynucleotide is positioned between nucleotide 13 and 14 of SEQ ID NO: 1.

89

37. The method of any one of claims 8 or 16-29, wherein said genetically- modified human immune cells comprise in their genomes a cassette comprising said nucleic acid sequence encoding said engineered antigen receptor and said nucleic acid sequence encoding said inhibitory molecule.

38. The method of claim 37, wherein said cassette comprises a first exogenous promoter that is operably linked to said nucleic acid sequence encoding said engineered antigen receptor, and a second exogenous promoter that is operably linked to said nucleic acid sequence encoding said inhibitory molecule.

39. The method of claim 38, wherein said first exogenous promoter is a Pol II promoter.

40. The method of claim 38 or claim 39, wherein said second exogenous promoter is a Pol II promoter or a Pol III promoter.

41. The method of any one of claims 37-40, wherein said cassette comprises a first termination sequence 5' downstream of said nucleic acid sequence encoding said engineered antigen receptor, and a second termination sequence 5' downstream of said nucleic acid sequence encoding said inhibitory molecule.

42. The method of claim 37, wherein said cassette comprises an exogenous promoter that is operably linked to said nucleic acid sequence encoding said engineered antigen receptor and said nucleic acid sequence encoding said inhibitory molecule.

43. The method of claim 42, wherein said exogenous promoter is a Pol II promoter.

44. The method of claim 42 or claim 43, wherein said cassette comprises a termination sequence downstream of said nucleic acid sequence encoding said engineered antigen receptor and said nucleic acid sequence encoding said inhibitory molecule.

90

45. The method of any one of claims 37-44, wherein said cassette is positioned within a gene, and wherein expression of said gene is disrupted by said inhibitor polynucleotide.

46. The method of claim 45, wherein said gene is a T cell receptor alpha gene, a T cell receptor alpha constant region (TRAC) gene, a T cell receptor beta gene, or a T cell receptor beta constant region (TRBC) gene.

47. The method of claim 45 or claim 46, wherein said gene is a TRAC gene, and wherein said cassette is positioned within SEQ ID NO: 1.

48. The method of any one of claims 45-47, wherein said gene is a TRAC gene, and wherein said cassette is positioned between nucleotide 13 and 14 of SEQ ID NO: 1.

49. The method of any one of claims 1-15, wherein said genetically-modified human immune cells comprise an inactivated dCK gene.

50. The method of any one of claims 1-49, wherein up to about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100% of said human immune cells in said population are said genetically-modified human immune cells.

51. The method of any one of claims 1-50, wherein between about 20% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

52. The method of any one of claims 1-51, wherein between about 30% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

53. The method of any one of claims 1-52, wherein between about 40% to about

99% of said human immune cells in said population are said genetically-modified human immune cells.

91

54. The method of any one of claims 1-53, wherein between about 50% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

55. The method of any one of claims 1-54, wherein between about 60% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

56. The method of any one of claims 1-55, wherein between about 70% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

57. The method of any one of claims 1-56, wherein between about 80% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

58. The method of any one of claims 1-57, wherein between about 90% to about 99% of said human immune cells in said population are said genetically-modified human immune cells.

59. The method of any one of claims 1-54, wherein between about 50% to about 80% of said human immune cells in said population are said genetically-modified human immune cells.

60. The method of any one of claims 1-54, wherein between about 60% to about 70% of said human immune cells in said population are said genetically-modified human immune cells.

61. The method of any one of claims 1-60, wherein said nucleoside analog is fludarabine.

62. The method of any one of claims 1-61, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject at a dose between about 10 to about 40 mg/m²/day.

92

63. The method of any one of claims 1-62, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject at a dose between about 20 to about 40 mg/m²/day.

64. The method of any one of claims 1-63, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject at a dose of about 30 mg/m2/day.

65. The method of any one of claims 1-64, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily for at least one day, or for multiple days, within 7 days prior to administration of said pharmaceutical composition.

66. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 5 days and ending 3 days prior to administration of said pharmaceutical composition.

67. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 4 days and ending 2 days prior to administration of said pharmaceutical composition.

68. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 3 days and ending 1 day prior to administration of said pharmaceutical composition.

69. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 2 days prior and ending on the same day as administration of said pharmaceutical composition.

70. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 1 day prior and ending 1 day after administration of said pharmaceutical composition.

71. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 5 days and ending 4 days prior to administration of said pharmaceutical composition.

72. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 4 days and ending 3 days prior to administration of said pharmaceutical composition.

73. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 3 days and ending 2 days prior to administration of said pharmaceutical composition.

74. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 2 days and ending 1 day prior to administration of said pharmaceutical composition.

75. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting 1 day prior and ending on the same day as administration of said pharmaceutical composition.

76. The method of any one of claims 1-65, wherein said lymphodepletion regimen comprises administering said nucleoside analog to said subject daily starting on the same day as and ending 1 day after administration of said pharmaceutical composition.

77. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 2 days and ending 4 days after administration of said pharmaceutical composition.

78. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 3 days and ending 5 days after administration of said pharmaceutical composition.

79. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 4 days and ending 6 days after administration of said pharmaceutical composition.

80. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 5 days and ending 7 days after administration of said pharmaceutical composition.

81. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 6 days and ending 8 days after administration of said pharmaceutical composition.

82. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 7 days and ending 9 days after administration of said pharmaceutical composition.

83. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 8 days and ending 10 days after administration of said pharmaceutical composition.

84. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 9 days and ending 11 days after administration of said pharmaceutical composition.

85. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 10 days and ending 12 days after administration of said pharmaceutical composition.

86. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 11 days and ending 13 days after administration of said pharmaceutical composition.

95

87. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 12 days and ending 14 days after administration of said pharmaceutical composition.

88. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 13 days and ending 15 days after administration of said pharmaceutical composition.

89. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 14 days and ending 16 days after administration of said pharmaceutical composition.

90. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 2 days and ending 3 days after administration of said pharmaceutical composition.

91. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 3 days and ending 4 days after administration of said pharmaceutical composition.

92. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 4 days and ending 5 days after administration of said pharmaceutical composition.

93. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 5 days and ending 6 days after administration of said pharmaceutical composition.

94. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 6 days and ending 7 days after administration of said pharmaceutical composition.

96

95. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 7 days and ending 8 days after administration of said pharmaceutical composition.

96. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 8 days and ending 9 days after administration of said pharmaceutical composition.

97. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 9 days and ending 10 days after administration of said pharmaceutical composition.

98. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 10 days and ending 11 days after administration of said pharmaceutical composition.

99. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 11 days and ending 12 days after administration of said pharmaceutical composition.

100. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 12 days and ending 13 days after administration of said pharmaceutical composition.

101. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 13 days and ending 14 days after administration of said pharmaceutical composition.

102. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject daily starting 14 days and ending 15 days after administration of said pharmaceutical composition.

103. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 2 days after administration of said pharmaceutical composition.

104. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 3 days after administration of said pharmaceutical composition.

105. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 4 days after administration of said pharmaceutical composition.

106. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 5 days after administration of said pharmaceutical composition.

107. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 6 days after administration of said pharmaceutical composition.

108. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 7 days after administration of said pharmaceutical composition.

109. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 8 days after administration of said pharmaceutical composition.

110. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 9 days after administration of said pharmaceutical composition.

98

111. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 10 days after administration of said pharmaceutical composition.

112. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 11 days after administration of said pharmaceutical composition.

113. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 12 days after administration of said pharmaceutical composition.

114. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 13 days after administration of said pharmaceutical composition.

115. The method of any one of claims 1-76, wherein said lymphodepletion regimen comprises re-administering said nucleoside analog to said subject once 14 days after administration of said pharmaceutical composition.

116. The method of any one of claims 1-115, wherein said one or more chemotherapeutic agents includes cyclophosphamide.

117. The method of claim 116, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject at a dose between about 400 to about 1500 mg/m²/day.

118. The method of claim 116 or claim 117, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject at a dose between about 500 to about 1000 mg/m²/day.

119. The method of any one of claims 116-118, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject at a dose of about 500 mg/m²/day.

99

120. The method of any one of claims 116-119, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject daily for at least one day, or for multiple days, within 7 days prior to administration of said pharmaceutical composition.

121. The method of any one of claims 116-120, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject daily beginning 6 days and ending 4 days prior to administration of said pharmaceutical composition.

122. The method of any one of claims 116-120, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject daily beginning 5 days and ending 3 days prior to administration of said pharmaceutical composition.

123. The method of any one of claims 116-120, wherein said lymphodepletion regimen comprises administering cyclophosphamide to said subject daily beginning 4 days and ending 2 days prior to administration of said pharmaceutical composition.

124. The method of any one of claims 1-123, wherein said pharmaceutical composition is administered to said subject at a dose between about 0.3xl0⁶ to about 6.0xl0⁶ genetically-modified human immune cells/kg.

125. The method of any one of claims 1-124, wherein said pharmaceutical composition is administered to said subject at a dose of about 0.5xl0⁶ to about 3.0xl0⁶ genetically-modified human immune cells/kg.

126. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 0.5xl0⁶ genetically-modified human immune cells/kg.

127. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about l.OxlO⁶ genetically-modified human immune cells/kg.

100

128. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 1.5xl0⁶ genetically-modified human immune cells/kg.

129. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 2.0xl0⁶ genetically-modified human immune cells/kg.

130. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 2.5xl0⁶ genetically-modified human immune cells/kg.

131. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 3.0xl0⁶ genetically-modified human immune cells/kg.

132. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 270xl0⁶ genetically-modified human immune cells.

133. The method of any one of claims 1-125, wherein said pharmaceutical composition is administered to said subject at a dose of about 500xl0⁶ genetically-modified human immune cells.

134. The method of any one of claims 1-133, wherein said lymphodepletion regimen comprises administering to said subject an effective amount of a biological lymphodepletion agent.

135. The method of claim 134, wherein said biological lymphodepletion agent is an antibody.

136. The method of claim 135, wherein said antibody has specificity for a cell surface antigen present on endogenous T cells.

101

137. The method of claim 136, wherein said cell surface antigen is CD3 or CD52.

138. The method of any one of claims 1-133, wherein said lymphodepletion regimen does not comprise administering to said subject a biological lymphodepletion agent.

139. The method of any one of claims 1-138, wherein said target cells are cancer cells.

140. The method of claim 139, wherein said method reduces the size of said cancer in said subject.

141. The method of claim 139 or claim 140, wherein said method eradicates said cancer in said subject.

142. The method of any one of claims 1-141, wherein said method is a method of immunotherapy .

102